Zscan4c

ES cells were infected with lentiviruses expressing shRNAs targeting Zscan4c (Millipore Sigma) or a control empty vector (PLKO). The following shRNA target sites were used: Zscan4c-sh1: 5′-CCAGATAATGAGCAGATGCC ACTCGAGTGGCATCTGCTCATTATCT GG-3′; Zscan4c-sh3: 5′-GAATGCAACAACTCTTGTAATCTCGAGAT TACAAGAGTTGTTGCATTCT-3′; and Zscan4c-sh4: 5′-CGCCAATC ATCCACTTACCAT CTCGAGATGGTAAGTGGATGATTGGCG-3′.

Immunofluorescence and IF–FISH were performed as previously described^{6 (link)}. In brief, cells fixed with 2% paraformaldehyde were incubated with the following primary antibodies, all at 1:1,000 dilution: OCT3/4 (sc-5279, Santa Cruz Biotechnology), p-KAP1 (A300-767A, Bethyl) or ZSCAN4C (AB4340, Millipore Sigma), γH2AX (05–636, Millipore), 53BP1 (NB100-304, Novus Biological). For IF–FISH, following secondary antibody staining, cells were fixed, denatured at 72 °C and hybridized with the AlexaFluor 488-TelC (TAACCC) PNA probe (PNA Bio). Slides were then mounted using ProLong Gold antifade reagent (Life Technologies), and images were acquired using a Zeiss Axio Imager M2 and an Axiocam 702 camera and ZEN 2.6 (blue edition) software. For ES cells, Z-stack images were acquired and displayed as maximum intensity projections. Final figures were assembled using Adobe Photoshop CC 2020 versions 21.0.1.47 and 21.2.1.265 and Adobe Illustrator 2020 24.2. Complete details regarding the number of cells analysed for each figure are provided in Supplementary Table 2.