Splice-blocking antisense morpholino oligos (MO's) against syne1b, nup37, and nup43 were designed by and purchased from GeneTools, Inc. Sequences (5′-3′): zsyne1b MO-I, e44i44, CCTGGAAATCAAACTTACCTGTAGT; zsyne1b MO-II, e38i38, GCTCTGAAGATGAAGCGTACCTTGA; znup43 MO-I, e7i7, GCAGCGAAATCATTGCTTACTCTGT; znup43 MO-II, e4i4, ATGCGCCACAAAACACTTACCAATA; znup37 MO-I, e4i4, AAAAAGAGAGCTACCTTCACATCAC; znup37 MO-II, e3i3, ACACAAGTTCAAAACTATACCTGA; Standard Control MO, CCTCTTACCTCAGTTACAATTTATA. Nup37 and nup43 MO were used at 7ng, and syne1b MO was used at 8ng. Zebrafish embryos at the 1-2 cell stage were injected with 1 nL of morpholino or 350 pg RNA in water buffered with 5 mM HEPES. For RNA-rescue experiments, pCS2 clones containing sequence-verified Nup37 and Nup43 open reading frames were obtained from the Harvard plasmid repository (HsCD00324272; HsCD00339012). Full length mRNA was transcribed using mMessage machine (Ambion), purified, and analyzed with the Tape Station.
Haskell G.T., Jensen B.C., Samsa L.A., Marchuk D., Huang W., Skrzynia C., Tilley C., Seifert B., Rivera-Muñoz E.A., Koller B., Wilhelmsen K.C., Liu J., Alhosaini H., Weck K.E., Evans J.P, & Berg J.S. (2017). Whole Exome Sequencing Identifies Truncating Variants in Nuclear Envelope Genes in Patients with Cardiovascular Disease. Circulation. Cardiovascular genetics, 10(3), e001443.
+ Open protocol