Sybr green 1

Total RNA was isolated from cell specimens using the guanidinium thiocyanate-phenol method. The extract integrity was assessed by 1.5% agarose gel electrophoresis, and RNA was visualized by ethidium bromide staining. The total amount of RNA was determined spectrophotometrically. RT-PCR assay was performed according to De Petro et al. [17 (link)] with slight modifications. An aliquot of total RNA (1 μg) was use for RT. The RT product (2 μL) was diluted with the PCR buffer (50 mM KCl, 10 mM Tris-HCl, and 2 mM MgCl₂) to a final volume of 50 μL, containing 0.5 μM dNTPs (final concentration, 0.8 mM) and 0.5 unit of Super-Therm Taq DNA polymerase (Southern Cross Biotechnology, Cape Town, South Africa). PCR was performed on a GeneAmp PCR system 2400 (Applied Biosystems, Foster City, CA). The ODN primers used in RT-PCR were as described previously [18 (link)]. The PCR products were analyzed by 1.5% agarose gel electrophoresis and direct visualization after SYBR Green I (Cambrex Bio Science Rockland, Inc., Rockland, ME) staining. The agarose gel was scanned and analyzed using the Kodak Scientific 1D Imaging System (Eastman Kodak Company, New Haven, CT).

Mouse tail tendons from 3, 6, and 12 week old WT and Hspg2^{Δ3−∕Δ3−} mice were pooled (n = 6 at each age point) to provide ∼50 mg wet weight of tissue for each RNA isolation. Tendons were snap frozen in liquid nitrogen, freeze-shattered using a Mikro dismembranator (B. Braun Biotech International, Melsungen, Germany) and total RNA extracted using Trizol (Invitrogen, Mulgrave, VIC, Australia), purified using Qiagen RNeasy columns (Qiagen, Chadstone Centre, VIC, Australia) and quantified by NanoDrop (ThermoFisher Scientific, Scoresby, VIC, Australia). RNA (1 µg) from each sample was reverse transcribed using Omniscript Reverse Transcription Kit (Qiagen) with random pentadecamers (50 ng/ml; Sigma-Genosys, Castle Hill, NSW, Australia) and RNase inhibitor (10 U per reaction, Bioline, Sydney, NSW, Australia). The cDNA was subjected to qRT-PCR in a Rotorgene 6000 (Qiagen) using Immomix (Bioline, Sydney, NSW, Australia), SYBR Green I (Cambrex Bioscience, Rockland, ME, USA), and 0.3 µM validated murine-specific primers. Relative copy numbers for genes of interest were determined using a standard curve generated from pooled cDNA normalised to Gapdh. PCR primer specificity was confirmed by sequencing (SUPAMAC, Sydney University). Genes, primers, and annealing temperatures are listed in Table 1.

Inoculated leaves of NbPCaP1L knockdown N. benthamiana were collected and ground. Total RNA was extracted as described (Lin et al., 2007 (link)). First-strand cDNA was synthesized with 20 pmole 39d(T) oligo primer and reverse transcriptase (Promega) according to the manufacturer’s protocol. Real-time quantitative PCR was performed in a 20 μl-reaction containing a 1000X dilution of SYBR green I (Cambrex Bio Science Rockland, ME, USA) with primer GT11_5′ (5′- AAGGTTGTTCCAAAATTAAAGC-3′) and GT11_3′ (5′- TTCAATCCTGAAACCTTTGGTCCC-3′) in 0.2-ml PCR tubes. The conditions began with an initial hold at 95°C for 5 min, followed by 30 cycles of 94°C for 30 sec, 56°C for 30 sec and 72°C for 30 sec. The expression of β-actin was amplified with the primer pair actin_5′ (5′ GATGAAGATACTCACAGAAAGA 3′) and actin_3′ (5′ GTGGTTTCATGAATGCCAGCA 3′) as an internal control for normalization.