Vdr-KO primary keratinocyte cells on a 6 cm collagen coated dish were infected with rat-Vdr- AdV at moi of 10. At 24 h after infection, 10 nM of 1,25D3 were added and after 5 h, cells were lysed in ISOGEN II (Nippon Gene, Tokyo, Japan), and then RNAs were collected along with ISOGEN II protocol. The cDNAs were synthesized using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan). PCR was performed on Real-Time PCR System (Thermal cycler Dice Real Time System III, Takara, Shiga, Japan) with SYBR green master mix, and the primers shown in Supplemental Table 1 were used for q-PCR.
Isogen 2
Manufactured by Nippon Gene
Sourced in Japan, Germany
ISOGEN II is a nucleic acid isolation reagent designed for the extraction and purification of RNA from various biological samples. It is a guanidinium-based solution that facilitates the effective lysis of cells and the subsequent isolation of high-quality RNA.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (42 mentions)
Thunderbird sybr qpcr mix, by Toyobo (35 mentions)
Revertra ace, by Toyobo (31 mentions)
Primescript rt master mix, by Takara Bio (24 mentions)
Revertra ace qpcr rt master mix with gdna remover, by Toyobo (23 mentions)
Revertra ace qpcr rt master mix, by Toyobo (23 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (22 mentions)
Primescript rt reagent kit, by Takara Bio (21 mentions)
Sybr premix ex taq 2, by Takara Bio (15 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (12 mentions)
Revertra ace qpcr rt kit, by Toyobo (11 mentions)
Thermal cycler dice real time system, by Takara Bio (11 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (10 mentions)
Steponeplus, by Thermo Fisher Scientific (10 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (10 mentions)
Gdna remover, by Toyobo (9 mentions)
Rneasy mini kit, by Qiagen (9 mentions)
Kapa sybr fast qpcr kit, by Roche (9 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (8 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (8 mentions)
458 protocols using isogen 2
1
Vdr-KO Keratinocyte Transcriptome Analysis
2
Pancreas RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pancreas was crushed using Lysing Matrix D (MP Biomedicals Germany GmbH, Eschwege, Germany) and ISOGEN II (Nippon Gene Co., LTD, Tokyo, Japan) at 4 °C, and total RNA was extracted following the instructions provided with ISOGEN II. The cDNA was synthesized from total RNA using ReverTra Ace (Toyobo Inc., Osaka, Japan). The qPCR analysis was carried out using Luna Universal qPCR Master Mix (New England Biolabs, Inc., Ipswich, MA, USA) and primer sets (Table 1 ) on an Aria Mx Real-time PCR System (Agilent Technologies, Inc., Santa Clara, CA, USA). Target gene expression was normalized to that of 18S rRNA, and the relative expression was calculated using the ΔΔCt method.
3
Measuring Wound Healing Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure the mRNA expression levels of several genes associated with wound healing, we harvested skin wound tissues for RT-PCR analysis 3 or 7 days after treatment. Briefly, wound tissues were homogenized using Multi-beads shocker® (Yasui Kikai), and RNA purification were performed using ISOGEN2 (Nippon Gene) according to the manufacturer’s protocol. The ReverTra Ace® q-PRC RT kit with genomic DNA remover (TOYOBO) was used to prepare the cDNA from the purified total RNA. RT-PCR was performed using a THUNDERBIRD SYBR qPCR mix (TOYOBO) and CFX96 Touch real-time PCR detection system (Bio Rad). The primer sequences used to quantify gene expression levels are listed in Supplemental table 1 .
4
Pancreatic Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from pancreatic tissue using ISOGEN2 (Nippon Gene, Tokyo, Japan), and cDNA was generated using a High-Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific). Quantitative reverse-transcription PCR was performed using Fast SYBR Green Master Mix (Thermo Fisher Scientific) and a 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA). Gene expression levels were normalized to that of GAPDH as an internal reference. Primer sequences are available upon request.
5
TIM-3 Knockdown Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from short hairpin RNA (shRNA)-mediated TIM-3 knockdown (KD) KASUMI-3 cells (by sh hepatitis A virus cellular receptor 2 [shHAVCR2]-1 and shHAVCR2-2) and scrambled control cells using Isogen2 (NIPPON GENE). Gene expression profiling was performed using SurePrint G3 human GE microarray 8 × 60 k version 2.0 (Agilent) per the protocol provided by the manufacturer. Briefly, cyanine-3–labeled complementary RNA (cRNA) was synthesized using the Low Input Quick Amp Labeling kit (Agilent), single-color, and 600 ng of cRNA from each sample was fragmented and hybridized to the array using a Gene Expression Hybridization Kit (Agilent). The array was scanned using an Agilent SureScan microarray scanner, and raw microarray data were loaded into the Gene Spring GX software (version 14.5; Agilent). In accordance with the guided workflow for Agilent single-color experiment, the normalization algorithm of 75th percentile shift was used, and the preprocessing baseline was adjusted to the median of all samples. Statistical analysis for gene set enrichment analysis was performed as described.
6
Gastric Organoid RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the mouse antrum using ISOGEN2 (Nippon Gene, Tokyo, Japan) following the manufacturer's directions. RNA was extracted from gastric organoids using an RNeasy mini kit. cDNA was generated using a high-capacity RNA-to-cDNA kit (Thermo Fisher Scientific, Waltham, MA, USA). Quantitative real-time polymerase chain reaction (qRT-PCR) amplification of cDNA was performed in duplicate using Fast SYBR Green Master Mix (Thermo Fisher Scientific) and a 7900HT Fast Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). qRT-PCR was performed using the following conditions: 95°C for 15 min, followed by 45 cycles of 95°C for 15 s, 55°C for 30 s, and 72°C for 30 s. The following primers were used: cyclinD1 (F: gctgcaaatggaactgcttctggt, R: taccatggagggtgggttggaaat), CDX2 (F: gctgccacacttgggctctc, R: cggctgaggctgggaaggtt), Tff2 (F: gcagtgctttgatcttggatgc, R: tcaggttggaaaagcagcagtt), Itln1 (F: tgctaccagaggttgcagtg, R: tgctcctgcttgatttcctt), ATP6v0d2 (F: ggaagctgtcaacattgcaga, R: tcaccgtgatccttgcagaat), and Gapdh (F: gacatcaagaaggtggtgaagcag, R: ataccaggaaatgagcttgacaaa).
7
Quantitative RNA Profiling of hiPS Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from hiPS cells cultured on plates and EBs using Sepasol-RNA I Super G (NACALAI TESQUE, Kyoto, Japan) and ISOGEN-2 (NIPPON GENE, Tokyo, Japan), respectively, according to the manufacturer’s instructions. RNA was used to synthesize cDNAs with a Superscript VILO cDNA synthesis kit (Thermo Fisher Scientific). qRT-PCR was carried out with StepOnePlus real-time PCR system (Thermo Fisher Scientific) using Fast SYPR Green Master Mix (Thermo Fisher Scientific). Results were analyzed with ∆∆Ct method, normalized by the internal reference, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primer sequences are described in Table S1 . Heatmap of expression profile was generated using Heatmapper (http://www.heatmapper.ca/ ).
8
Real-Time PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues using Isogen 2 (Nippon Gene Co., Ltd., Toyama, Japan) and dissolved in nuclease-free water. RNA concentration was determined by measuring UV absorption, and 400 ng of total RNA was reverse-transcribed using PrimeScript RT reagent kits (TaKaRa Bio, Shiga, Japan) to obtain first-stranded cDNA. A cDNA aliquot was subjected to a real-time PCR using SYBR Select Master Mix and a 7500 Fast Real-time PCR system (Thermo Fisher Scientific, MA, U.S.A.). Sequences of the forward and reverse primers used for the amplification of specific cDNA sequences are listed in Table 1. The amplified products were verified by checking the melting curves after the final cycle of each PCR. Gene expression was normalized to β-actin and quantified using the ΔΔCt method.
Statistical Analyses Two-way ANOVA was carried out to determine the effects of T 3 on nucleosome content and protein and gene expression levels. The T 3 -administered groups were compared by Bonferroni's/Dunn post hoc test and the shamoperated and GCI mouse groups were compared by unpaired Student's t-test. In the study on the time courses of T 3 levels in serum and the hippocampus, ANOVA and unpaired Student's t-test were carried out to compare between vehicle-and T 3 -administered groups.
Statistical Analyses Two-way ANOVA was carried out to determine the effects of T 3 on nucleosome content and protein and gene expression levels. The T 3 -administered groups were compared by Bonferroni's/Dunn post hoc test and the shamoperated and GCI mouse groups were compared by unpaired Student's t-test. In the study on the time courses of T 3 levels in serum and the hippocampus, ANOVA and unpaired Student's t-test were carried out to compare between vehicle-and T 3 -administered groups.
9
Gene Expression Analysis via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the whole adult body (for measuring msl-2 expression knocked down by act5c-GAL4) and from the dissected larval central nervous system (for measuring Sxl expression knocked down by elav-GAL4) using Isogen II (Nippon Gene, Tokyo, Japan), and then RT-qPCR was performed using a One Step SYBR PrimeScript PLUS RT-PCR kit (Takara Bio, Shiga, Japan) and Applied Biosystems ABI Prism 7000 Sequence Detection System. All mRNA expression levels were normalized to the levels of rp49 mRNA. We used the following primers for qPCR (5′-3′) for detecting msl-2 and Sxl mRNA levels: Sxl, forward primer (5ʹ-CCAATCTGCCGCGTACCATA-3ʹ), reverse primer (5ʹ-AATGGAACCGTACTTGCCGA-3ʹ); msl-2, forward primer (5ʹ-CACTGCGGTCACACTGGCTTCGCTCAG-3ʹ), reverse primer (5ʹ-CTCCTGGGCTAGTTACCTGCAATTCCTC-3ʹ); and rp49, forward primer (5ʹ-GATGACCATCCGCCCAGCATAC-3ʹ), reverse primer (5ʹ-AGTAAACGCGGTTCTGCATGAGC-3ʹ).
10
Quantification of mRNA and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mRNA quantification, RNA was extracted from cells using ISOGEN II (Nippon Gene, Tokyo, Japan) and reverse-transcribed to complementary DNA using ReverTra Ace qPCR RT Master Mix and gDNA Remover (TOYOBO, Osaka, Japan). For miRNA quantification, RNA was extracted using the miRNeasy Mini Kit (Qiagen, Venlo, Netherlands) and reverse-transcribed with the Taqman MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific). Quantitative PCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) with a pre-designed TaqMan probe and primer sets targeting DNMT1 (Hs00945875_m1), EZH2 (Hs00544830_m1), matrix metalloproteinase (MMP) 10 (Hs00233987_m1), MMP3 (Hs00968305_m1), MMP13 (Hs00942584_m1), MMP15 (Hs00233997_m1), MMP19 (Hs00419424_m1), GAPDH (4333764T), miR-152 (000475), and RNU6B (001093) (Thermo Fisher Scientific) according to the manufacturer's instructions. Relative mRNA expression and miRNA expression were determined with respect to GAPDH expression and RNU6B expression, respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!