T4 dna polymerase

The DNA fragment coding for an N-terminally truncated version of the GtfB protein (amino acids 616–1593) was amplified from L. fermentum NCC 2970 chromosomal DNA using Phusion DNA polymerase (Finnzyme, Helsinki, Finland) and cloned into a modified pET15b vector using ligation-independent cloning (LIC). The primers used for amplifying the N-terminally truncated gtfB gene derivative incorporated 5′ extensions (underlined) to facilitate the LIC cloning, and were: Forward CAGGGACCCGGTTTTGGTAAAGATGGTCGGATTG and Reverse CGAGGAGAAGCCCGGTTAATTGTCTTCAATATTAGCATAATAATC. The resulting PCR product was purified from the agarose band and digested in the presence of dATP, with the 3′ to 5′ exonuclease activity of the T4 DNA polymerase (New England Biolabs). In parallel, the pET15b/LIC vector was digested with KpnI, isolated from gel and then treated with T4 DNA polymerase (New England Biolabs) in the presence of dTTP. The treated pET15b/LIC vector and the amplicon were mixed together in a 1:4 molar ratio, and the mixture was used to transform Escherichia coli DH5α cells (Phabagen). This resulted in a gtfB-ΔN construct containing an N-terminal His6-tag cleavable by a 3 C protease. The constructed expression vector pET15b/gtfB-ΔN was transformed into host E. coli BL21 Star (DE3). The gene sequence was verified by nucleotide sequencing (GATC, Cologne, Germany).

For deletions of the NES and NLS sequences in GFP-SETDB1 expression plasmid (Cho et al., 2013 (link)), we used CRISPR/Cas9 technology. Thirty mM of sgRNA was preincubated with 30 mM of Cas9 nuclease (Toolgen) at RT for 10 min before reaction with GFP-SETDB1 plasmid at 37°C for additional 15 min. After spin-column purification, Cas9-generated sticky ends of the plasmid were repaired by T4 DNA polymerase (New England Biolabs, NEB) and Klenow enzyme (NEB). The resulting plasmid was then self-ligated using T4 DNA ligase (NEB) and T4 DNA ligase buffer (NEB). For preparing the NESx variant, the NES2-SETDB1 plasmid harboring the NES1 deletion was first constructed and, with this plasmid as template, we repeated the deletion process for the NES2 sequence. Information on the sgRNA sets used is as following: 5′-aga​gau​ugc​uga​gcu​gca​gcagg-3′ and 5′-acu​ucg​uca​gua​cau​uga​ugagg-3′ for NES1 deletion; 5′-agu​gac​uaa​cug​uga​guc​uuugg-3′ and 5′-gua​uca​uga​cag​uag​cuc​ugagg-3′ for NES2 deletion; and 5′-aua​guc​agc​aug​cgg​auu​cuggg-3′ and 5′-agg​acu​aag​aca​ugg​cac​aaagg-3′ for NLS deletion.

Around 0.5 μg of genomic DNA from protonema tissue was extracted,sheared (by sonication), end repaired (10 µl T4 DNA ligase buffer (NEB B0202S), 4 µl 10 mM dNTP mix, 1 µl T4 DNA polymerase (NEB M0203S), 1 µl Klenow DNA polymerase (NEB M0210S), 1 µl T4 PNK (NEB M0201S), water to 100 µl), A-tailed (5 µl Klenow buffer (NEB2), 10 µl 1 mM dATP, 1 µl Klenow exo minus (NEB M0212S), water to 50 µl), and ligated to methylated-adapters (25 µl quick ligase buffer (NEB), 1 µl 10 mM preannealed bs-seq-adapters (Supplementary Table 2), 1 µl DNA quick ligase (NEB M2200S), water to 50 µl). Adaptor-ligated libraries were subjected to two sequential treatments of bisulfite conversion using the EpiTect Bisulfite kit (Qiagen). Bisulfite-converted libraries were amplified by PCR (2.5 U of ExTaq DNA polymerase (Takara Bio), 5 µl of 10x Extaq reaction buffer, 25 mM dNTPs, 1 µl bs-seq-primers (Supplementary Table 2), and adding water to 50 µl). PCR program: 95 °C for 3 min, then 12–14 cycles of 95 °C for 30 s, 65 °C for 30 s, and 72 °C for 60 s. Between library preparation steps and following PCR, DNA was purified with the solid-phase reversible immobilization method using AM-Pure beads (Beckman Coulter) and quantified with Bioanalyzer (Agilent). Deep sequencing was performed on Illumina Hi-Seq 2000.

The appa gene was targeted by CRISPR/Cas9 mutagenesis. CHOPCHOP (http://chopchop.cbu.uib.no) was used to identify an sgRNA to exon 18 of appa (ENSDARG00000104279).³⁴ (link) Cas9 mRNA was made from pT3TS-nCas9n (Addgene, plasmid 46757)⁷⁷ (link) using mMESSAGE mMACHINE transcription kit (Thermofisher Scientific). Constant oligomer (5′AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCT AGCTCTAAAAC-3′) and the appa gene-specific oligomer targeting the conserved 25-42 amino acid region of Aβ in appa (target sequence: 5′-GAGGACGTGAGCTCCAATAA- 3′) were annealed on a PCR machine (using the program 95°C, 5 min; 95°C ->85°C, -2°C/second; 85°C ->25°C, -0.1°C/second, 4°C) and filled in using T4 DNA polymerase (NEB) using manufacturers’ instructions at 12°C for 20 min.⁷⁸ (link) The template was cleaned up using a PCR clean-up column (Qiaquick) and the 120 bp product was verified on a 2% agarose gel. The sgRNA was transcribed from this DNA template using Ambion MEGAscript SP6 kit.⁷⁸ (link) 1 nl of a 1 μl of Cas9 mRNA (200 ng/μl) and 1 μl purified sgRNA (25 ng/μl) containing mixture were co-injected into one-cell stage embryos. Injected F0 embryos were raised to adulthood, fin-clipped and deep-sequenced by Illumina Sequencing (below).

Cells were incubated with SNAIL-QBC-anchor oligonucleotide (5′-pGCTCCCTGTCTGACGCATACACTAAAGATAACAT) at a concentration of 5 nM for 8 h at 37 °C in PBS, 1× SSC, 0.1% Tween, 40 U/mL RNasin. The annealed SNAIL-QBC-anchor oligonucleotide was extended by T4 DNA polymerase to synthesize the sequence complementary to the RNA SeqTag. Cells were washed once with 1X PBST and resuspended in a reaction containing 0.2 μM QBC-anchor oligonucleotide, 0.1 mg/ml BSA, 0.1 mM of each dNTP (NEB, N0447), 1x PRL buffer, and 3 units T4 DNA polymerase (NEB, M0203S) in 1xPBS to total volume of 100 μl. The reaction was incubated at 37 °C for 30 min. Cells were washed two times with HSM buffer. Splint added and split-pool as described above

All chemicals were purchased from AppliChem GmbH (Darmstadt, Germany), except citrus pectin, galacturonic acid, polygalacturonic acid sodium salt, and D-(+)-glucosamine hydrochloride were obtained from Sigma-Aldrich Chemie GmbH (Steinheim, Germany). Microbial substrates like wheat bran, sugar beet pulp pellets, and molasses were obtained from local suppliers (Bremer Rolandmühle Erling GmbH & Co. KG, Bremen, Germany; Nordzucker AG, Uelzen, Germany; Golden Sweet, Meckenheim, Germany). Restriction enzymes, T4 DNA polymerase, and T4 DNA ligase were purchased from New England Biolabs (Frankfurt am Main, Germany). Oligoprimers and DNA sequencing services were ordered from Eurofins (Ebersberg, Germany).