Sybr qpcr master mix

A total of five bacteria were quantified from each fecal DNA sample using real-time fluorescent quantitative polymerase chain reaction (PCR). DNA amplification and detection were performed by using a Roche LightCycler 96 real-time PCR instrument (Roche Diagnostics Co., Ltd., Basel, Switzerland). Samples were routinely analyzed using SYBR Green qPCR Master Mix in a total volume of 20 µL. Each reaction consisted of 2 µL template DNA, 7 µL ddH2O, 10.0 µL of 2 × SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China), 0.5 µL of primer 1, and primer 2 (10 µM), and real-time PCR conditions included an initial denaturation step of 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 30 s, primer optimal annealing temperature annealing (Table 1) for 30 s, extension at 72 °C for 30 s, and extension at 72 °C for another 8 min. At the end of the PCR assay, a dissociation curve analysis was performed to check for nonspecific products and/or SYBR Green probe contamination. The relative quantification method was used, and the relative expression of the strains was calculated using the formula as follows:

Total RNA were extracted from tissue samples and cells using the Trizol reagent (Invitrogen, USA). RNA concentration was determined by absorbance at 260nm, and RNA purity was assessed based on absorbance at 260/280 nm with NanoDrop2000 (Thermo Scientific, USA). Reverse transcription was performed using HiScript II Q RT SuperMix (Vazyme, China) to prepare cDNA. Then, quantitative real-time PCR was performed using 2× SYBR qPCR Master Mix (Vazyme, China) for all samples in triplicate in the CFX96 Real-Time PCR System (Bio-rad, USA). Human GAPDH gene was used as the control to normalize the mRNA expression of target genes using 2^-ΔΔCT method. Primer sequences involved in this study were shown in Supplementary file 1: Table S2.

Total RNA was extracted using the TRIZOL reagent method and then reverse transcribed into cDNA using reverse transcription supermix (R222-01, Vazyme, China). Quantitative real-time PCR (q-PCR) was conducted using 2× SYBR qPCR master mix (Q311-02, Vazyme, China). The primers (Table S1) were synthesized by Sangon Biotechnology Co. (China). Relative gene expression was calculated using the 2^−ΔΔCT method with β-actin as an endogenous reference.

Total RNA was extracted from MDA-MB-231 and E0771 by FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme, Nanjing, China) according to the manufacturer’s protocol. RNA samples were assessed by NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies). cDNA was synthesised from 500 ng of RNA using HiScript III Enzyme Mix (Vazyme). RT-PCR mixtures were prepared by 2 × SYBR qPCR Master Mix (Vazyme) according to the manufacturer’s protocol using the following procedure: 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s, and final 72 °C for 10 min. Experiments were carried out in triplicate. GAPDH was served as internal control, all primers sequences were: human GAPDH, forward CACATCGCTCAGACACCATG and reverse TGACGGTGCCATGGAATTTG; human CDH1, forward CCCGGGACAACGTTTATTAC and reverse GCTGGCTCAAGTCAAAGTCC; mouse GAPDH, forward TTCACCACCATGGAGAAGGC and reverse GGCATGGACTGTGGTCATGA; mouse CDH1, forward CTCCAGTCATAGGGAGCTGTC and reverse TCTTCTGAGACCTGGGTACAC.

Total RNA was extracted from each sample from each growth stages according to the protocol by the manufacturer (Huayueyang). The first-strand cDNA was synthesized using the instruction manual of First-Strand cDNA Synthesis Kit (Vazyme). Gene-specific primers for RT-qPCR were designed using the Primer 5.0 software (primer sequences were summed in Supplementary Table S3), using the housekeeping gene TBP-associated factor 15B (TAF15b) as an internal control for relative gene expression analysis^{51 (link)}. The RT-qPCR reaction system contained 10 μl 2 × SYBR qPCR MasterMix (Vazyme), 2 μl template cDNA, 0.4 μl primers, and was made up to 20 μl with ddH₂O. The amplification process was performed using the following protocol: 95 °C for 3 min, followed by 45 cycles at 95 °C for 10 s and 60 °C for 30 s. Three biological replicates were measured per reaction. Relative expression levels of the genes were calculated by the 2^−ΔΔCt method. The error bar for each expression level was calculated based on the biological replicates using Microsoft Excel 2019.

RNA was isolated from the mouse brain (cerebrum and brainstem) via standard Trizol extraction followed by isopropanol precipitation. The cDNA was synthesized using Reverse Transcription SuperMix (R222-01, Vazyme, China), and then RT-PCR was performed with 2 × SYBR qPCR Master Mix (Q311-02, Vazyme, China) according to the manufacturer’s instruction. The following primers were used: TfR1 Forward Primer 5′-GTTTCTGCCAGCCCCTTATTAT-3′ and Reverse Primer 5′-GCAAGGAAAGGATATGCAGCA-3′; ACSL4 Forward Primer 5′-TGTGCATCCCGC-GATGATT-3′ and Reverse Primer 5′-AGTCCAGGGATACGTTCACAC-3′; GPX4 Forward Primer 5′-TGTGCATCCCGCGATGATT-3' and Reverse Primer 5′-CCCTGTACTTATCCAGGCAGA-3′; GAPDH Forward Primer 5′-TGTGCATCCCGCGATGATT-3′ and Reverse Primer 5′-CCCTGTAC-TTATCCAGGCAGA-3′. The relative mRNA expression of TfR1, ACSL4, and GPX4 was calculated via the 2^−ΔΔCT method and standardized to GAPDH.