Cfx manager 3

cDNA synthesis was performed using the iScript cDNA synthesis kit according to manufacturer’s instructions (Bio-Rad) with 1.5 μg total RNA as input. Real-time PCR primers were designed with Beacon Designer software (Premier Biosoft International) avoiding template secondary structure (Table 2). Primer efficiencies (Table 2) were calculated using serial dilutions of MoneyMaker genomic DNA and CFX Manager 3.0 software (Bio-Rad). Reference transcripts were chosen based on published works: act41 and ubi3 (Rotenberg et al., 2006 (link)). Stable expression between treatments was validated using the Best Keeper program and four independent RNA samples from each treatment. Real-time PCR experiments were performed as described (Jahn et al., 2008 (link); Cowles et al., 2016 (link)). Experiments were performed using the CFX96 Real-Time System and analyzed with the CFX Manager 3.0 software (Bio-Rad). The mean Cq of each target transcript was normalized by the mean Cq of each reference gene using the formula: 2^{(−(Cq target − Cq reference))}. As previously described (Rotenberg et al., 2006 (link)), we determined the relative expression ratio (RER) of the target gene by dividing the normalized target RNA by a calibrator consisting of the average of the normalized values of the control samples (expression after water treatment in these experiments).

Statistical analysis of the qPCR results was performed in analogy to the described earlier method^{53 (link)}. PCR efficiency of each reaction was ranged from 92% to 99%. The results from the biological replicates for particular samples were gathered to determine the mean normalized expression and its standard deviation (Bio-Rad CFX Manager 3.0). The normalized relative expression of ZsGreen1 from biological replicates for siRNAs and control siRNA was compared at a significance level of 0.05 or 0.01 using Bio-rad CFX Manager 3.0. Statistically significant differences in mean expression between tested siRNAs and control siRNA (P < 0.05 or P < 0.01) were observed but not in all samples.

Total RNA was extracted from cultures using RNeasy mini-kit (Qiagen) and reverse transcribed to cDNA using reverse transcriptase PCR (RT-PCR). The amount of cDNA was normalised to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin expression. QPCR reactions were performed on a Biorad CFX 96 Connect Real-Time PCR System using the Quantitect SYBR Green PCR Kits (Qiagen) according to the manufacturer’s instructions. The real-time PCR results were analysed using the Biorad CFX Manager 3.0 to calculate normalized relative expression (ΔΔCq) of target genes normalized to relative expression levels of the reference genes β-actin and GAPDH, using the Pfaffl method (Pfaffl 2001 (link)). All error bars on QPCR graphs were standard errors of the mean. Primers were from Qiagen: β-actin (QT01680476), GAPDH (QT01192646), P0U5F1-octamer binding transcription factor (OCT-4) (QT00210840), PAX6—paired box 6 (QT00071169), RAX—retina and anterior neural fold homeobox (QT00212667), OTX2 orthodenticle homeobox 2 (QT00213129), SIX3 Six homeobox 3 (QT00211897), CRX Cone-rod homeobox (QT01192632), NRL Neural retina leucine zipper (QT01005165), RHO Rhodopsin (QT00035700).

Total RNA was extracted from in vitro samples using the RNeasy^® Plant Micro and RNeasy^® Plant Mini kits (Qiagen) according to the manufacturer’s instruction. cDNAs were obtained from 2 µg of RNA using the Superscript™ II reverse transcriptase (Invitrogen) according to Solís et al. (2012) (link). RT-qPCR analyses were performed using the SsoAdvanced™ Universal SYBR^®Green Supermix on the iQ™5 Real-Time PCR Detection Sytem (Biorad). The oligonucleotides used are described in Supplementary Table S2, and qPCR conditions were as previously described (Berenguer et al., 2017 (link)). All qPCRs were run in duplicate, and the Cyclophilin gene was used as the internal reference gene. Transcript levels were normalized to the vacuolated microspore levels. Data were analysed with the Bio-Rad CFX Manager 3.0 (3.01224.1015) (Biorad), using the Livak calculation method (Livak and Schmittgen, 2001 (link)).

We used the RNeasy Mini Kit (Qiagen, Germantown, MD, USA) to isolate the total
mRNA from injured spinal cord segments (1 cm containing and surrounding the
lesioned area) 3 days after SCI. One milliliter Trizol (Life Technologies) was
used to homogenize the tissues, and RNA was extracted according to the
manufacturer's protocol. We synthesized cDNA from 1 μg
total RNA using iScript cDNA synthesis Kit (Bio-Rad, Hercules, CA, USA) after
treatment with DNase (Promega, Madison, WI, USA). We used SYBR-Green based
technology to perform real-time PCR in the CFX Connect Real-Time PCR Detection
System (Bio-Rad); the following primers were used: nitric oxide synthase 2
(iNOS2) (Fw: AAACCCCAGGTGCTATTCCC; Rv: GAACATTCTGTGCAGTCCCA); monocyte
chemoattractant protein 1 (MCP-1):( Fw: ACGCTTCTGGGCCTGTTGTT; Rv:
CCTGCTGCTGGTGATTCTCT); Interleukin-1 beta (IL-1β): (Fw: TGGCAACT
GTCCCTGAACTC; Rv: GTCGAGATGCTGCTGTGAGA). We analyzed the data using Bio-Rad CFX
Manager 3.0 (Bio-Rad). The gene glyceraldehyde-3-phosphate dehydrogenase (GADPH)
was chosen as reference. The mRNA level of each target gene was normalized by
GADPH and expressed as 2^ΔCt (ΔCt = Ct
target -Ct GADPH). The relative quantity in mRNA levels of tested genes was
determined by the equation: relative quantity =
1000/2^ΔCt.