According to the manufacturer’s instructions, total RNA was extracted with an RNA Fast2000 kit (Fastagen, Shanghai, China). RNA was reverse transcribed using PrimeScript RT Reagent Kit with gDNA Eraser (Takara). According to the manufacturer’s instructions, the quantification of gene transcripts was performed by quantitative Real-Time PCR using TB Green (Takara) and the ABI7500Fast Real-Time PCR systems (ABI) instructions. Data were normalized by the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression level in each sample, and the 2-△△Ct method was used to calculate relative expression changes. With the help of dissociation curve analysis and the sequencing of PCR products, pairs of specific primers of each cDNA were designed and selected without any primer-dimers or unspecific amplification detected. The specific primers for individual genes were as follows: Ocilrp2, 5’-TTCTGGATACCCACGTAACTGG-3’ (sense) and 5’-TCCCCCTTGAATCTCTTTAGGAA-3’ (antisense); IL-6, 5’-TAGTCCTTCCTACCCCAATTTCC-3’ (sense) and 5’-TTGGTCCTTAGCCACTCCTTC-3’ (antisense); Nkrp1f, 5’-TTAGGTGTCCAGGGTATAAGCA-3’ (sense) and 5’-AGCACAGCCAGATTTCAGAGC-3’ (antisense); Nkrp1g, 5’-AACCCTGTGTCCTGACTCCT-3’ (sense) and 5’-CTTTGTGCCACTAACGGTGC-3’ (antisense); Gapdh, 5’-GGTGAAGGTCGGTGTGAACG-3’ (sense) and 5’-CTCGCTCCTGGAAGATGGTG-3’ (antisense).
Rnafast2000 kit
Manufactured by Fastagen
Sourced in China
The RNAfast2000 kit is a laboratory equipment designed for the extraction and purification of RNA from biological samples. It provides a fast and efficient method for isolating high-quality RNA for various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (2 mentions)
Nebnextr ultra rna library prep kit, by New England Biolabs (2 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Hiseq 4000 sequencer, by Illumina (2 mentions)
Abi7500fast real time pcr systems, by Thermo Fisher Scientific (1 mentions)
Tb green, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Sybr rt pcr kit, by Toyobo (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Revertra ace qpcr rt master mix, by Toyobo (1 mentions)
Primescript rt master mix perfect real time kit, by Takara Bio (1 mentions)
Uv illumination, by Bio-Rad (1 mentions)
Quantity one analysis software version 4, by Bio-Rad (1 mentions)
Abi 7500 system, by Bio-Rad (1 mentions)
Sybr green dye, by Takara Bio (1 mentions)
Sybr green of rt master mix, by Takara Bio (1 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Takara Bio (1 mentions)
8 protocols using rnafast2000 kit
1
Quantitative Real-Time PCR Protocol
2
Quantitative PCR analysis of immune genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells and animal tissues using TRIzol reagent (Ambion) or RNAfast2000 kit (Fastagen). ReverTra Ace qPCR RT master mix (Toyobo) was used to synthesize cDNA.Quantitative PCR analysis was performed by Q7 (ABI) using the SYBR RT-PCR kit (TOYOBO). Sequences of the primers for qPCR were listed as follows: Ifnb forward, 5’-ATGAGTGGTGGTTGCAGGC-3’; Ifnb reverse, 5’- TGACCTTTCAAATGCAGTAGA-3’; Ifnα4 forward, 5’- TACTCAGCAGACCTTGAACCT; Ifnα4 reverse, 5’-CAGTCTTGG CAGCAAGTTGAC-3’; Tnf forward, 5’-AAGCCTGTAGCCCACGTCGTA-3’; Tnf reverse, 5’-GGCACCACTAGTTGGTTGTCTTTG-3’; Il6- forward, 5’- TAG TCCTTCCTACCCCAATTTCC-3’; Il6 reverse, 5’- TTGGTCCTTAGCCACTCC TTC-3’; Isg15 forward, 5’- GGTGTCCGTGACTAACTCCAT-3’; Isg15 reverse, 5’-TGGAAAGGGTAAGACCGTCCT-3’; Ifit1 forward, 5’-CTGAGATGTCAC TTCACATGGAA-3’; Ifit1 reverse, 5’-GTGCATCCCCAATGGGTTCT-3’; Ccl5 forward, 5’-GCTGCTTTGCCTACCTCTCC-3’; Ccl5 reverse, 5’-TCGAGTGAC AAACACGACTGC-3’; Cxcl10 forward, 5’- CCAAGTGCTGCCGTCATTTTC-3’; Cxcl10 reverse, 5’- GGCTCGCAGGGATGATTTCAA-3’.
3
RT-PCR Analysis of β3 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated using RNA fast 2000 kit (Fastagen, Shanghai, China) according to the manufacturer's protocols. The RNA was subsequently reverse transcribed into cDNA using Prime Script RT Master Mix Perfect Real-Time kit (DRR036A; Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocols. The primers sequences used (Sangon Biotech Co., Ltd., Shanghai, China) were: β3, forward 5′-GCCAGCACCATCTCTTTACC-3′ and reverse 5′-GCACTCTCTCCCTTTGAGGA-3′, with a length of 112 bp; β-actin, forward 5′-TGACGTGGACATCCGCAAAG-3′ and reverse 5′-CTGGAAGGTGGACAGCGAGG-3′, with a length of 205 bp. The cycling protocol for PCR involved incubating the samples at 94°C for 2 min followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec, with a final cycle of incubation at 72°C for 2 min. The amplification products were analyzed by electrophoresis (Beijing Junyi, Beijing, China) in agarose gels and detected under UV illumination (Bio-Rad Laboratories, Inc., Hercules, CA, USA) after staining with nucleic acid dye (DuRed; FanBo Biochemicals, Beijing, China). Images were analyzed using a quantitative analysis system (Quantity One Analysis Software, version 4.6.2; Bio-Rad Laboratories, Inc.).
4
Quantitative Real-Time PCR Analysis of Blood RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total blood RNA was isolated using an RNAfast2000 kit (Fastagen, Shanghai, China). cDNA was prepared using the reverse transcriptase method as described by the manufacturer (PrimeScript RT reagent Kit, TaKaRa, Dalian, China) and subjected to quantitative real-time PCR using the primers presented inTable 1 and SYBR Green dye (TaKaRa, Dalian, China). The PCR program was as follows: 95°C for 1 min, followed by 30 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 30 mins, and a final elongation of 10 mins at 72°C. Amplification and melting curves were prepared using an ABI 7500 system (Bio-Rad, Gibbstown, NJ, USA). A relative quantification (RQ) method was employed to calculate the relative levels of target gene mRNA, using β-actin as an internal reference gene. cDNA from normal rat blood extract served as a control reference sample. The equation was as follows: RQ=2−ΔΔCT, where ΔΔCT=(CT target gene−CT β-actin)embolism group−(CT target gene−CT β-actin)sham group.
Total blood RNA was isolated using an RNAfast2000 kit (Fastagen, Shanghai, China). cDNA was prepared using the reverse transcriptase method as described by the manufacturer (PrimeScript RT reagent Kit, TaKaRa, Dalian, China) and subjected to quantitative real-time PCR using the primers presented in
The forward and reverse primers used
| RNA | Forward primer | Reverse primer |
|---|---|---|
| MMP-9 | AGCCGGGAACGTATCTGGA | TGGAAACTCACACGCCAGAAG |
| TIMP-1 | CGAGACCACCTTATACCAGCGTTA | TGATGTGCAAATTTCCGTTCC |
| β-actin | GGAGATTACTGCCCTGGCTCCTA | GACTCATCGTACTCCTGCTTGCTG |
5
Transcriptome Analysis of DKC1 and TERC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from primary tissues using a RNAfast2000 kit (Fastagen). cDNA was synthesized using a PrimeScript™ RT reagent Kit (TAKARA). qPCR was performed using SYBR Green of RT Master Mix (TAKARA) to determine mRNA levels of target genes based on 2(− ΔΔCT) values. β-Actin mRNA levels were used as the internal control for normalization of target gene expression. PCR primers were: DKC1: 5′-ATGGCGGATGCGGAAGTAAT-3′ (forward) and 5′-CCACTGAGACGTGTCCAACT-3′ (reverse). TERC: 5′-ACCCTAACTGAGAAGGGCGTA-3′ (forward) and 5′-AATGAACGGTGGAAGGCGG-3′ (reverse). β-actin: 5′-CATGTACGTTGCTATCCAGGC-3′ (forward) and 5′-CTCCTTAATGTCACGCACGAT-3′ (reverse).
Sequencing libraries were generated using NEBNextR Ultra™ RNA Library Prep Kit (New England Biolabs) following manufacturer’s recommendations. RNA sequencing was carried out using Illumina HiSeq 4000 sequencer at Metware Biotechnology (Wuhan, China). Paired-end reads were quality controlled by Q30 and Cutadapt software (v 1.9.3) was used to remove low-quality reads and 3’ adaptor-trimming. Hisat2 (v 2.0.4) was further used to align clean reads from RNA sequencing, and sequencing depth and gene length were adjusted by Fragments Per Kilobase of transcript per Million fragments mapped.
Sequencing libraries were generated using NEBNextR Ultra™ RNA Library Prep Kit (New England Biolabs) following manufacturer’s recommendations. RNA sequencing was carried out using Illumina HiSeq 4000 sequencer at Metware Biotechnology (Wuhan, China). Paired-end reads were quality controlled by Q30 and Cutadapt software (v 1.9.3) was used to remove low-quality reads and 3’ adaptor-trimming. Hisat2 (v 2.0.4) was further used to align clean reads from RNA sequencing, and sequencing depth and gene length were adjusted by Fragments Per Kilobase of transcript per Million fragments mapped.
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNA fast 2000 kit (Fastagen, Shanghai, China). Reverse transcription of RNA to cDNA was obtained using PrimeScript™ RT Master Mix (Takara,Shiga, Japan). qPCR was performed with QuantStudio 5 Detection System (ABI, Thermo Fisher) in a 10 μl reaction mixture containing SYBR GreenII. Expression of different genes were normalized to GAPDH and were analyzed using the 2−ΔΔCT method.
7
RNA-seq Analysis of Primary Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from primary tissues and cells using a RNAfast2000 kit (Fastagen) and quality control was performed using NanoDrop ND-1000 (Thermo Fisher Scientific). RNA sequencing was performed on 10 paired specimens. Sequencing libraries were generated using NEBNextR Ultra™ RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s recommendation. RNA sequencing was carried out using Illumina HiSeq 4000 sequencer at Metware Biotechnology (Wuhan, China). Paired-end reads were quality controlled by Q30 and Cutadapt software (v 1.9.3) was used to remove low-quality reads and 3’ adaptor-trimming. Hisat2 (v 2.0.4) was further used to align clean reads from sequencing, and sequencing depth and gene length were adjusted by Fragments Per Kilobase of transcript per Million (TPM) fragments mapped. The sequencing data were deposited in the GEO database (GSE217386).
8
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with an RNA fast2000 kit (Fastagen, 220,011). The complementary DNA was synthesized with PrimeScript™ RT Master Mix (Takara, 036A). SYBR Green (Takara, 820A) was used following the manufacturer’s instructions for quantitative analyses. GAPDH was used as the reference gene. The relative expression in the tissues was calculated using 2−(∆Ct). The fold changes in CON and ODM or cytokine stimulation were calculated using 2−(∆∆Ct). The primer sequences are listed in Additional Table 2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!