Soft gel mixes contained: 550 µl of 7.6 mM hydrochloric acid (HCL), 330.5 µl of double-distilled water (ddH2O), 0.5 µl N,N,N′,N′-tetramethylethylenediamine (TEMED) (Sigma), 20 µl 2% bis-acrylamide (BioRad), 70 µl of 40% acrylamide (BioRad), 20 µl 0.1 M NHS (N-hydroxysuccinimide, Sigma-Aldrich), 4 µl of 200 nm diameter beads resuspended at 0.2 µM (Invitrogen) and 5 µl of 10% ammonium persulfate (GE HealthCare) (prepared just before use). Stiff gels mixes contained: 550 µl of 7.6 mM HCL, 258.5 µl of ddH2O, 0.5 µl of TEMED (Sigma), 25 µl 2% bis-acrylamide (BioRad), 137 µl of 40% acrylamide (BioRad), 20 µl of 0.1 M NHS (N-hydroxysuccinimide, Sigma-Aldrich), 4 µl of 200 nm diameter beads resuspended at 0.2 µM (Invitrogen) and 5 µl of 10% ammonium persulfate (GE HealthCare) (added just before use). A 12-μl drop of PAA mix was placed into the hydrophilic glass of a glass bottom dish (FD5040-100). The PAA mix was covered with a hydrophobic 13-mm diameter × 0.1 mm glass coverslips that were prepared fresh by coating them with PlusONE Repel-Silene ES (GE Healthcare) for 15 min at room temperature and dried with an air pistol. Polymerization proceeded for 45 min at room temperature in a humidifier chamber. The coverslip was carefully removed, and gels were washed three times for 2 min with 10 mM HEPES.
N hydroxysuccinimide nhs
Manufactured by Merck Group
Sourced in United States, Germany, China, United Kingdom, Japan, France, Canada, Italy, Spain, Poland, Australia, Ireland, India
N-hydroxysuccinimide (NHS) is a chemical compound used in various laboratory applications. It serves as an activating agent, primarily in the field of organic synthesis and biomolecular conjugation.
Automatically generated - may contain errors
Lab products found in correlation
1 ethyl 3 3 dimethylaminopropyl carbodiimide edc, by Merck Group (58 mentions)
N 3 dimethylaminopropyl n ethylcarbodiimide hydrochloride edc, by Merck Group (55 mentions)
1 ethyl 3 3 dimethylaminopropyl carbodiimide hydrochloride edc, by Merck Group (29 mentions)
Bovine serum albumin (bsa), by Merck Group (29 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (28 mentions)
Sodium hydroxide (naoh), by Merck Group (20 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (17 mentions)
N ethyl n 3 dimethylaminopropyl carbodiimide edc, by Merck Group (15 mentions)
1 3 dimethylaminopropyl 3 ethylcarbodiimide hydrochloride edc, by Merck Group (14 mentions)
N 3 dimethylaminopropyl n ethylcarbodiimide hydrochloride, by Merck Group (13 mentions)
N n dicyclohexylcarbodiimide dcc, by Merck Group (12 mentions)
2 n morpholino ethanesulfonic acid mes, by Merck Group (11 mentions)
Tween 20, by Merck Group (11 mentions)
Hydrochloric acid (hcl), by Merck Group (11 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (11 mentions)
N 3 dimethylaminopropyl n ethylcarbodiimide edc, by Merck Group (10 mentions)
Chitosan, by Merck Group (10 mentions)
Ethanol, by Merck Group (9 mentions)
Phosphate buffered saline (pbs), by Merck Group (9 mentions)
Trypsin edta, by Thermo Fisher Scientific (9 mentions)
424 protocols using n hydroxysuccinimide nhs
1
Polyacrylamide Gel Fabrication
2
Synthesis and Functionalization of Magnetic Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Iron acetylacetonate (Fe (acac)3), 1,2-hexadecanediol, benzyl ether, oleyamine (OLA), oleic acid (OA), sodium dodecyl sulfate (SDS), dopamine hydrochloride (DP), 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC), and N-hydroxysuccinimide (NHS) were purchased from Millipore-Sigma (Darmstadt, Germany). Dulbecco’s Modified Eagle’s Medium (DMEM) with high glucose and fetal bovine serum (FBS) were purchased from Thermo Fisher Scientific (Waltham, MA, USA). NH2-PEG-COOH (molecular weight =2,000 Da) was purchased from Seebio Biological (Shanghai, China). DOX hydrochloride was purchased from Sangon Ltd. (Shanghai, China). Anti-EGFR antibody was obtained from Ruiying Biological (Suzhou, China). Other reagents (analytical grade) were purchased from Beijing Chemical Reagents Company (Beijing, China) unless otherwise stated.
3
Carboxyl Group Activation with EDC/NHS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Carboxyl groups (-COOH), 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, MW = 191.70 g/mol; MilliporeSigma), and N-hydroxysuccinimide (NHS, purity >98%, MW = 115.09 g/mol; MilliporeSigma) solutions (0.01 M) were prepared and mixed at a 1:1 ratio in 0.1 M 2-(N-morpholino)ethanesulfonic acid (MES) buffer (MES sodium salt, MW = 217.2 g/mol; MilliporeSigma).
4
Formulating Targeted Sonosensitive Drug Delivery
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1,2-Dipalmitoyl-sn-glycerol-3-phosphoethanolamine (DPPC) and 1,[2-dipalmitoyl-sn-glycerol-3-phosphoethanolamine]-N-[amino(polyethylene glycol)] (DPPE-PEG2000-NH2) were purchased from Ponsure Biotechnology (Shanghai, China, Lot). The commercial SonoVue®, diluting with 5 mL of saline to form MBs, was purchased from Bracco Diagnostics Inc (Geneva, Switzerland). PTX was purchased from Dalian Meilun Biology Technology Co., Ltd (Dalian, China). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and N-hydroxysuccinimide (NHS) were purchased from Sigma-Aldrich Co., Ltd (Shanghai, China). RGD peptide was purchased from CornerStone Therapeutics (Shanghai), Ltd (Shanghai, China). 1-(3-Dimethylamino-propyl)-3-ethylcarbodiimide hydrochloride (EDC) and cholesterol were purchased from Sinopharm Chemical Reagent Co., Ltd (China).
MDA-MB-231 triple-negative breast cancer cell line was provided by the State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute (Shanghai, China). BALB/c nu/nu female mice, weighing 18–20 g, were provided by the Animal Experiment Centre of Shanghai Cancer Institute. All animal procedures were performed in accordance with the Guidelines for Care and Use of Laboratory Animals of Shanghai Jiao Tong University and approved by the Animal Ethics Committee of Shanghai Cancer Institute (License no. SYXK (Hu) 2012-0001).
MDA-MB-231 triple-negative breast cancer cell line was provided by the State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute (Shanghai, China). BALB/c nu/nu female mice, weighing 18–20 g, were provided by the Animal Experiment Centre of Shanghai Cancer Institute. All animal procedures were performed in accordance with the Guidelines for Care and Use of Laboratory Animals of Shanghai Jiao Tong University and approved by the Animal Ethics Committee of Shanghai Cancer Institute (License no. SYXK (Hu) 2012-0001).
5
Aluminosilicate Genosensor for EGFR Mutation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aluminosilicate nanocomposites extracted from joss fly ash collected in a local Chinese temple in the Northern region of Malaysia. 1,1′-Carbonyldiimidazole (CDI), Tween-20 detergent, Tris-buffer, (3-Aminopropyl)triethoxysilane (APTES), phosphate-buffered saline (PBS), 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), and N-hydroxysuccinimide (NHS) used for the surface enhancement of genosensor were procured from Sigma Aldrich, USA. Genomic sequences designed to detect EGFR mutation were purchased from Integrated DNA Technologies, USA. Carboxyl-terminated genome (5′ COOH-C6-CAGCAGTTTGGCCCGCCCAAAA 3′) was used as a probe for DNA immobilization. The complementary mutant strand (5′ TTTTGGGCGGGCCAAACTGCTG 3′), single base pair mismatch strand (5′ TTTTGGGCTGGCCAAACTGCTG 3′) and non-complementary strand (5′ CAGCAGTTTGGCCCGCCCAAAA 3′) were used as targets in the detection strategies20 (link).
6
EDA core PAMAM dendrimer functionalization
7
Cathepsin D Inhibitor Interaction Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following reagents were used in the experimental part: Cathepsin D protein (SIGMA, Steinheim, Germany) and its specific inhibitor—pepstatin A (SIGMA, Steinheim, Germany), human albumine, (SIGMA, Steinheim, Germany), N-hydroxysuccinimide (NHS) (SIGMA ALDRICH, Munich, Germany), N-Ethyl-N′-(3-dimethylaminopropyl) carbodiimide (EDC) (SIGMA ALDRICH, Munich, Germany), cysteamine hydrochloride acting as a linker (SIGMA ALDRICH, Munich, Germany), phosphate-buffered saline (PBS) pH = 7.4 (BIOMED, Lublin, Poland), acetate buffer pH = 3.50 (BIOMED, Lublin, Poland), carbonate buffer pH = 8.50–9.86 (BIOMED, Lublin, Poland).
The solvents used to prepare solutions were absolute ethanol 99.8% (POCh, Gliwice, Poland) and MilliQ water (Simplicity® Millipore). Measurements were performed with two types of glass chips coated with ultrathin metal layers: the first with a 50 nm layer of gold (Sens, Netherlands), and the second evaporated with a 42 nm layer of silver and a 5 nm layer of gold (Bialystok University of Technology).
The solvents used to prepare solutions were absolute ethanol 99.8% (POCh, Gliwice, Poland) and MilliQ water (Simplicity® Millipore). Measurements were performed with two types of glass chips coated with ultrathin metal layers: the first with a 50 nm layer of gold (Sens, Netherlands), and the second evaporated with a 42 nm layer of silver and a 5 nm layer of gold (Bialystok University of Technology).
8
Chondrocyte Isolation and Expansion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Type I insoluble collagen prepared from bovine skin (Devro Plc), and chondroitin-6-sulphate (Bioiberica) were used to prepare collagen–GAG scaffolds. 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) and N-hydroxysuccinimide (NHS) were purchased from Sigma Aldrich. Human recombinant IGF-1 was purchased from R&D Systems. Human chondrocytes were derived from knee articular cartilage donated from patients (N = 3) undergoing total knee replacement surgery with full ethical consent 06/Q0108/213. Full depth articular cartilage was removed from femoral condyles and tibial plateaux using a scalpel. The tissue was then minced finely before incubating in a 0.2 % (w/v) solution of bacterial collagenase (Roche) in complete medium (DMEM, 10 % FCS plus antibiotics) overnight at 37 °C. Released cells were washed twice to remove any collagenase before plating on plastic. Chondrocytes were expanded and used at passage three in order to retain as much of the chondrogenic phenotype as possible. All experiments were carried out using cells derived from N = 3 individual donors.
9
Carboxymethyl Chitosan and Horseradish Peroxidase Conjugation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Carboxymethyl chitosan and horseradish peroxidase were purchased from Solarbio (Beijing, China). All the antibodies were bought from Proteintech Group Inc (Wuhan, China). Dopamine hydrochloride, Hyaluronic acid (MW = 5 × 105 Da), Calcein-AM, 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxy succinimide (NHS) were purchased from Sigma Aldrich (St Louis, USA).
10
Synthesis and Characterization of Multifunctional Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CUR was purchased from Aladdin Industrial Corporation (Shanghai, China). 1,2-distearoyl-sn-glycero-3-phosphoe-thanolamine (DSPE), 1,2-distearoyl-sn-glycero-3-phos-phoethanolamine-N-[carboxyl(polyethylene glycol)-2000] (DSPE-PEG-COOH), and DSPE-MPEG were provided by Avanti Polar Lipids. Cy5.5 was from Molecular Probes Inc. (Eugene, OR, USA). DSPE-PEG-Cy5.5 was prepared according to our previous literature.43 Bis-hydroxyl poly (ethyleneglycol) (PEG, molecular weight of ~2,000) was provided by Sinopeg Biotech Co., Ltd. (Xiamen, China). MTX and FA were purchased from Bio Basic Inc. (Markham, Ontario, Canada). N,N′-Dicyclohexylcarbodiimide, N-hydroxysuccinimide (NHS), and N,N′-disuccinimidyl carbonate were purchased from Sigma-Aldrich Co., Ltd. (St Louis, MO, USA). DAPI was obtained from Molecular Probes Inc. (Eugene, OR, USA). MTT was purchased from Amresco (Solon, OH, USA). RPMI-1640, trypsin, and penicillin–streptomycin were ordered from Sigma Chemical Corp. (St Louis, MO, USA). Fetal bovine serum was purchased from Thermo Fisher Scientific (Waltham, MA, USA). All other chemicals and reagents were purchased from Sigma-Aldrich Co., Ltd., unless otherwise noted.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!