Gotaq qpcr

Total RNA was extracted using the Hot borate method described by Wan and Wilkins [97 (link)], the cDNA strand was synthesized with the HiScriptII Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme Cat No. R223-01). RT-qPCR was performed with GoTaq® qPCR and RT-qPCR Systems (Promega Cat No. A6001) using a Light Cycler 480 Real-Time PCR Detection System (Roche, Rotkreuz, Switzerland). Primers of LcGRASs, and two reference genes GAPDH and EF [98 (link)] were designed by Primer Premier 5.0 (Additional file 1: Table S7). Each expression profile was independently verified in three biological replicates. The relative expression level of each gene was calculated by the 2^-△△Ct method [99 (link)].

Total RNA was extracted with a QIAZol Lysis reagent (Qiagen), and GoScript™ Reverse Transcritase (Promega) was applied to synthesis cDNA; gene-specific primers of EYA4 forward ATAACACAGCCGATGGCACA and reverse TCCTGGTTGGTTAGTCAGTCC were used for QPCR (GoTaq® qPCR; Promega) on Prime Q real-time PCR machine (Techine), normalizing the amount of target gene to the house keeping gene GAPDH forward AATGGGCAGCCGTTAGGAAA and reverse AAAAGCATCACCCGGAGGAG [29 (link)]. PCR conditions are as follows: one cycle at 95°C for 15 minutes, followed by 36 cycles of 95°C for 30 seconds, then 30 seconds at 58°C and 30 seconds at 72°C, terminating the incubation by 1 cycle of 95°C for 1 minute, 58°C for 30 seconds, and 95°C for 30 seconds successively. The 2^−ΔΔCt method was applied to define the relative mRNA expression.

The total RNA of yak tissue was extracted using the Trizol method, and the integrity of RNA was identified with 1% agarose gel electrophoresis. cDNA was synthesized via reverse transcription using a translator first-strand cDNA synthesis kit (Roche, Shanghai, China) and stored at −20 °C for further analysis. Quantitative real-time polymerase chain reaction (RT-qPCR) was performed using Go Taq^®qPCR and RT-qPCR Systems (Promega, Madison, WI, USA) to investigate the expression levels of the GHR messenger RNA (mRNA) in each tissue. Three replicates were selected for each sample. The primer information is provided in Supplementary Table S1. The RT-qPCR conditions were as follows: 95 °C for 3 min, 95 °C for 5 s, 64 °C for 20 s for a total of 40 cycles, and 72 °C for 30 s. The results were analyzed using the 2^−ΔΔCT method [20 (link)].

Total RNA (1 µg) was reverse transcribed using the GoScript™ Reverse Transcription System (Promega), which includes oligo(dT) primers and random primers for the reverse transcription step, and qPCR was performed using GoTaq^® qPCR (Promega) and SYBR Green on a PRISM 7900HT system (Applied Biosystems). Each sample was analyzed in triplicate wells, and reactions without cDNA were included as negative controls. The thermal cycling conditions were as follows: 94 °C at 5 min (for the hot start step), followed by 40 cycles at 94 °C for 15 s and 60 °C for 30 s. The sequences of the primers used in this study are shown in Additional file 1: Table S1. The PCR data were processed by normalizing the median expression value of a given lncRNA to the expression of GAPDH in the same sample. Relative lncRNA-expression levels were quantified using the 2^−ΔΔCt method.

Total RNA samples from the HS5 cells cultured alone or with HMCLs^SCR or HMCLs^KD were extracted by TRI Reagent (Merck, Italy), following the manufacturer’s instructions. Total RNA (1 µg) was retrotranscribed using RevertAid M-MuLV Reverse Transcriptase (ThermoFisher). Quantitative PCR (qRT-PCR) reactions were carried out on a Step-One Plus PCR system (Applied Biosystems, Life Technologies Italia, Italy) using GoTaq^® qPCR (Promega, Italy). The primer sequences are reported in Table 2.

Total RNA was extracted using the RNeasy mini column (Qiagen, Cat: 74104), treated with DNase I (Qiagen, Cat: 79254), and the concentration was determined using NanoDrop spectrophotometer (Thermo Scientifics, 2000). Complementary DNA (cDNA) was synthesized using Bio-Rad iScript Advanced cDNA kit (Bio-Rad, Cat: 170-8842). Gene expression (2 μl of cDNA) was measured by GoTaq qPCR (Promega, Cat: A6001) for real time quantitative polymerase chain reaction (RT-qPCR). Nucleotide sequences for Fgf10 mRNA (Fw 5′-CACCTATGCATCTTTTAACTGGC-3′) (Rv 5′-TCTATGTTTGGATCGTCATGGGG-3′) was used and expression was normalized to Rpl32 (Fw 5′-GAGGACCAAGAAGTTCATCAGG-3′) (Rv 5′-CATTGTGGACCAGGAACTTGC-3′). The results were analyzed using the 7500 SDS software and relative expression was calculated to determine the fold change. Statistical analysis was performed in Prism 7.0 (GraphPad Software). Error bars on the results are presented as a standard error of the mean (SEM), and a p-value of <0.05 was considered significant. Statistical significance was evaluated using Student’s unpaired t-test. The full details of RT-qPCR protocols used are provided as Supplementary Material.