Quikchange lightning mutagenesis kit

Mutations in D06, E10’, and AT118i4h32 were introduced using the Quikchange Lightning mutagenesis kit (Agilent), and yeast were transformed using a standard transformation protocol. Polyreactive nanobody panel and mutant yeast were grown in -Trp + Glu media for two days at 30 °C and induced in -Trp + Gal media at 25 °C for two days. 1 × 10⁶ yeast were washed with DDM selection buffer, and were stained with a 1:10 dilution of either insect cell PSR reagent or Expi cell PSR reagent for 30 min at 4 °C with shaking. Following incubation with PSR reagent, yeast were washed with DDM selection buffer and were stained with a 1:100 dilution of Alexafluor-647 conjugated anti-HA antibody and 1:100 dilution of Alexafluor-488 conjugated streptavidin (Biolegend) for 15 min at 4 °C with shaking. Cells were washed once more with DDM selection buffer and analytical staining was performed using a BD Accuri C6 flow cytometer.

GCaMP5G^{28 (link)} was synthesized as gene strings (GeneArt, LifeTechnologies). Plasmid-encoding, maltose-binding protein MBP175-cpGFP^{44 (link)} and the pDisplay vector were a kind gift from L. Looger. dLight1.3b was synthesized as gene strings. For bacterial protein expression, the coding sequence of GCaMP5G was PCR amplified as a NdeI/HindIII fragment with a C-terminal His-tag and cloned into the pRSETa vector. All site-specific mutants in this study were generated using the QuikChange Lightning Mutagenesis Kit (Agilent Technologies). For creation of the switchable maltose sensor library, MBP leader sequences of varying length and with different linker sequences and MBP C terminus were amplified, cpGFP was amplified from rsGCaMP0.9 and different variants were constructed using overlap PCR and cloned into NdeI/XhoI of the pRSETa vector. For cytoplasmic mammalian expression of rsGCaMPs and the photo-switchable dopamine sensor, coding sequences were cloned into the pcDNA3.0 vector (Thermo Fisher Scientific) at the EcoR1 and Not1 sites. To target rsGCaMP1.4-ER and rsEGFP2 to the ER lumen, genes were cloned into the pEF/myc/ER vector (Invitrogen) at the SalI and NotI sites. For mammalian surface expression of the reversible switchable maltose sensor (Variant A), the gene was cloned into the pDisplay vector (Invitrogen) at the BglII and PstI sites.

The entire ORF of human FBL was amplified by PCR from a cDNA library and cloned into the expression vector pCMV2, generating the pCMV2-FBL plasmid. Site-directed mutagenesis was then performed on pCMV2-FBL using QuikChange Lightning Mutagenesis kit (Agilent Technologies). The resultant plasmid, pCMV2-FBLsi2, has five silent mutations in the target region of a siFBL-2. The forward and reverse primers used for generating pCMV2-FBLsi2 were 5’–gttggtcctcttcttggccagattgattaagtcacggccagagcggtggg– 3’ and 5’–cccaccgctctggccgtgacttaatcaatctggccaagaagaggaccaac– 3’, respectively. Using pCMV2-FBLsi2 as the template, the codons for E191 and D236 critical for catalytic activity were substituted with codons for alanine. Primers used for PCR-based mutagenesis of pCMV2-FBLsi2 were: E191A-F: tagtctatgcagtcgcgttctcccaccgctc, R: gagcggtgggagaacgcgactgcatagacta, D236A-F: gatgtgatctttgctgctgtggcccagccagac, R: gtctggctgggccacagcagcaaagatcacatc. Final sequences of FBL for all plasmids made were confirmed by DNA sequencing.

Coding sequences of human IDH1 or IDH2 were inserted into a pLenti-C-myc-DDK-IRES-Puro vector (Origene, Rockville, MD, USA) and pLVX-TetONE-Puro vector (Clontech, Mountain View, CA, USA). Pathogenic IDH1 variants (R132C, R132H) were generated by using the Quikchange lightning mutagenesis kit (Agilent, Santa Clara, CA, USA). The coding sequences of IDH1 or IDH2 were verified by sequencing the entire region of coding sequences of each vector.