Phusion taq polymerase

An extensive amino acid sequence alignment of previously characterized Lsi1 homologs (Deshmukh et al., 2015 (link)) revealed that a few residues within the inter‐NPA domain could account for the inability of NsLsi1 to act as a Si‐permeable channel (see Section 3). The SDPpred bioinformatics tool (bioinf.fbb.msu.ru/SDPpred/) was used to select amino acid variations that may determine functional differences between unique Lsi1 groups (Deshmukh et al., 2015 (link); Kalinina, Novichkov, Mironov, Gelfand, & Rakhmaninova, 2004 (link)), and the PROVEAN (Protein Variation Effect Analyzer) tool was used to predict the impact of amino acid changes on protein function (http://provean.jcvi.org/index.php; Choi, Sims, Murphy, Miller, & Chan, 2012 (link)). Based on this analysis, the variant residue in position 125, a proline (P) in NsLsi1 and phenylalanine (F) in other species, was targeted for further studies (for details, see Section 3).
A site‐directed mutagenesis approach was undertaken to perform the P125F substitution in NsLsi1 (for primer, see Table S1) using the Phusion Taq polymerase (New England Biolabs). The mutated construct was selected for through DpnI restriction and transformed in E. coli TOP10 competent cells (see Deshmukh et al., 2015 (link), for details). The mutation was confirmed by automated sequencing.

pCLV3:HEC1-linker-GR, pCUC2:HEC1-linker-GR and p16:HEC1-linker-GR constructs were generated by ligation of HEC1 coding sequence (CDS) with a 33 aa Serine-Glycin linker and GR tag into pDONOR221 vector and recombined in pGreenIIs constructs (Schuster et al., 2014 (link)). pKNOLLE:fast-mFluorescentTimer-NLS was generated from fast m-FluorescentTimer CDS fused to N7 NLS and introduced by subsequent BP and LR reactions (Thermo Fischer Scientist, Waltham, Massachusetts, USA) in a pGreenIIs vector containing 2.1 kb of genomic sequence upstream of the KNOLLE start codon. The CUC2 promoter used correspond to the 3.2 kb genomic sequence upstream the ATG. pCLV3:HEC1-linker-GFP, pCUC2:HEC1-linker-GFP, pCUC2:3xGFP-NLS and p35S:HEC1-linker-GFP were cloned using the Green Gate system (Lampropoulos et al., 2013 (link)). N7-NLS was used as NLS tag (Daum et al., 2014 (link)).
For Yeast-two-Hybrid and Bi-Fluorescence complementation (BiFC) assay, HEC1, HEC2, HEC3, MP, BDL and PEP CDS were PCR amplified using Phusion Taq-polymerase (New England Biolabs, Inc., Massachusetts, USA) and subsequently cloned by Gibson assembly in pGILDA/pB42AD (Yeast-two-Hybrid) (Gibson, 2011 (link)) or ligated in pGreenII0179 (SPYCE constructs) or pGreenII0229 (SPYNE cassettes) via NotI (BiFC complementation) (Rodríguez-Cazorla et al., 2015 (link); Waadt et al., 2008 (link))

Seedlings were grown on our standard medium for 5 days, after which root tissue was harvested for RNA isolation. Approximately 200 roots were pooled per genotype for each condition tested and duplicate analyses were performed. When harvesting the root tissue, the root meristem and mature region of the root were removed such that only the differentiation and elongation zones of the root were collected. Total RNA was isolated using the Qiagen RNeasy Plant Mini Kit protocol and then used in first-strand cDNA synthesis using SuperScript II Reverse Transcriptase according to the standard protocol (Invitrogen). For RT-PCR the VTI13 forward and reverse primers described in Supplementary Data Table S1 were used with the first-strand cDNA templates to amplify gene products using Phusion Taq polymerase (New England Biolabs).

The coding sequence of Vf_Mt3g092840 (VfTTG1) was amplified using standard PCR from NV648 using oligonucleotides: VfTTG1.F1: 5′‐ATGAGATCTAAAACTACGCCTGTGG/VfTTG1.R1: 5′‐TCAAACTCGAACCCTCAAAAGC (0.5 μm) using Phusion taq polymerase (N.E.B., Hitchin, UK). Thermal cycling conditions: 96 °C for 5 min, (30 × 96 °C/15 s, 58 °C/15 s, 72 °C/30 s) and 72 °C/10 min final extension. Products were cloned into a pGEM‐T Easy vector (Promega, Southampton, UK) and sequenced using BigDye V3.0 (Life Technologies, Paisley, UK).
A genome walking kit (Clontech, Mountain View (CA), USA) was used in conjunction with the VfTTG1.R1 primer to generate primary amplification products for walking. A nested primer (VfTTG1.N) 5′‐TCAAACCCTCAAAAGCTGCATCTTGTTAG was then used for walking upstream generating a 982‐bp product. This was cloned and sequenced as described previously.

Genomic DNA were isolated from freshly prepared PBMCs using QIAamp DNA mini kit (Qiagen) according to manufacturer’s instructions. The 3′UTRs of predicted miRNA target genes were PCR amplified using Phusion Taq polymerase (NEB, Ipswich, MA, USA). The amplified products were digested with restriction enzymes (Xho I and Not I) and ligated downstream to the luciferase reporter gene in psiCHECK™-2 vector (Promega). Dual luciferase assays were performed as described earlier (26 (link), 28 (link), 30 (link)).

The cDNA prepared from rice and date palm was used to amplify the open reading frames (ORF) of OsLsi1 and PdNIP2-1. The ORFs amplified using Phusion Taq polymerase (New England Biolabs, Whitby, ON, Canada) were first cloned in a pUC18 plasmid vector and sequenced to confirm the accuracy of the ORFs. For heterologous expression in Xenopus laevis oocytes, the ORFs were further cloned using EcoRI/XbaI restriction sites into the Pol1 vector (PdNIP2-1EcoR1F: CCGAATTCATGGCTTCCTTTCCGAGAC, PdNIP2-1Xba1R: GTTCAATTGGAAAATGTTTGATCTAGAGC), a X. laevis oocyte expression vector derived from pGEM and comprising the T7 promoter, the Xenopus globin untranslated regions and a poly(A) tract (Caron et al., 2000 (link)). Both the plasmid constructs, OsLsi1-Pol1 and PdNIP2-1-Pol1, were transformed into Escherichia coli TOP10 strain and stored at -80°C. Correctness of the constructs was checked by sequencing (T7P: TAATACGACTCACTATAGG, Xeno3UTR: GACTCCATTCGGGTGTTCTTG) prior to in vitro translation.

Total RNA from one‐month‐old root tissues was isolated as described above for tobacco, rice, and wheat. cDNAs were synthesized by oligo(dT) priming from 3 µg of RNA using Superscript III reverse transcriptase (Invitrogen). Genes of interest (NsLsi1, OsLsi1, and TaTIP2‐1) were PCR‐amplified subsequently using cDNA templates, gene‐specific primers (Table S1), and the Phusion Taq polymerase (New England Biolabs) (for details, see Deshmukh et al., 2015 (link)).