Sybr pcr master mix

For miRNAs quantification, cDNA synthesis was carried out with total RNA obtained from the 21T cell lines and tissue biopsies, using NCode VILO miRNA cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). For mRNAs quantification, cDNA synthesis was achieved, using High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA). Real-time PCR was performed using SYBR PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). The primers sequences employed in qRT-PCR reactions were: b-actin (F) 5´ CATCGAGCACGGCATCGT 3´; b-actin (R) 5´ GCCTGGATAGCAACGTACAT 3´, miR-205-5p (F) 5´ CTTCATTCCACCGGAGTCTG 3´ with the universal reverse primer provided on miRNA cDNA synthesis kit. All experiments were performed in triplicate. β- actin was chosen as reference gene since its expression levels were constant in our experimental conditions. Expression results were analyzed using the ΔΔCt method [11 (link)] and statistical analysis was done using unpaired T-test.

Total RNA was isolated using the RNeasy Mini Kit (QIAGEN, USA) according to the manufacturer’s instructions. Extracted RNA samples were treated with DNase I to remove potential DNA contamination. One microgram of total RNA was subjected to reverse transcription using a ProtoScript^®M-MuLV first-strand cDNA synthesis kit (New England Bio-Labs, Ipswich, MA, USA). All PCR reactions were performed in triplicate with an Applied Biosystems^® 7500 Fast Thermocycler (Foster City, CA, USA) with the following protocol: 50°C for 2 minutes, 95°C for 5 minutes, followed by 40 cycles of 95°C for 30 seconds and 60°C for 1 minute. Melting curve analysis was performed and a no-template control was included in every qPCR using Invitrogen SYBR^®PCR Master Mix (Thermo Fisher, Waltham, MA, USA). GADPH was used as internal controls. Expression levels for tested genes were calculated using the formula 2^-△Ct. The fold changes were determined by 2^-△△Ct. The relative tumor expression levels for genes were calculated by normalizing the value from the tumor against the mean average of values from the 11 normal pituitaries. Primers used in this study are listed in Table S1.

Total RNA was extracted from feather follicles representing the three genotypes at the IG locus using the RNAeasy Mini KIT (Qiagen). cDNAs were synthesized using The High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and then used as template to amplify COMTD1 transcripts. COMTD1 transcripts were examined by gel electrophoresis and verified with Sanger sequencing.
Total RNA isolated from B16F10 cells were reverse-transcribed into cDNA and analyzed by qPCR on ABI7500 Fast Real-Time PCR System (Thermo Scientific) using SYBR PCR master mix (Thermo Scientific). Ct value was first normalized to the housekeeping gene Hprt, then the average expression of Comtd1 in the WT cell line was assumed to be 1 for the subsequent calculation of the relative expression in KO cell lines. Primer sequences are available in S6 Table.

RNA was collected with TRIzol. One μg RNA was used for quantitative PCR using SYBR PCR mastermix (Thermo). Results were analyzed using 2(^–ΔΔCt) method. Primers were listed in Table 1.