Transfection reagent

The cells were seeded in 24-well plates at a density of 2.0 × 10⁴ cells/well and grown overnight. The next day, the transfection complex containing 0.5 μg of the ARE-luciferase plasmid along with 0.05 μg of pRLtk control plasmid (Promega, Madison, WI, USA) and the transfection reagent (WelGENE Inc.) was added to each well. After 18 h, the transfection complex was removed and the cells were incubated in a complete medium for 24 h. The cells were then lysed. Renilla and Firefly luciferase levels were measured using the Dual Luciferase Assay System (Promega) as described previously [58 ].

HEK293T cells were purchased from the ATCC (CRL-11268) with the cell line authentication test conducted by the Hong Kong University Pathology Laboratory, showing that the percent match is higher than 80% threshold for authentication and no mycoplasma contamination. HEK293T cells were cultured in DMEM supplemented with 10% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin at 37°C and 5% CO₂. HEK293T cells were seeded in 6-well plates and were transfected with pGL3-Scd1 promoter and adenoviral vector expressing either Adgrf1 (ADV-Adgrf1) or GFP (ADV-GFP) by using the transfection reagent (#E4981, Promega, WI), following the manufacturer’s instruction. DHEA (C3270, APExBIO, TX) was added into cells at the concentration of 100 μM and incubated at 37°C for 24 hr. For the luciferase reporter assay, pRL-TK (Renilla luciferase) reporter plasmid was used as a transfection control. The luciferase assays were performed by using the Dual-Luciferase Reporter Assay System (#E1960, Promega).

TALEN expression constructs (TAL 256 and TAL 278) were previously constructed with the Joung Lab REAL Assembly TALEN kit (Addgene, Watertown, MA, USA) [25 (link),61 (link)]. To assess DNA repair, HeLa cells (0.6 million) were seeded a day before transient transfection, co-transfected with a mCherry/GFP reporter plasmid and pairs of TALEN-expressing constructs [TAL 256 (200 ng) and TAL 278 (200 ng)] at a ratio of 1:3 [DNA (μg): Transfection reagent (μL)] with Viafect Transfection reagent (Promega, Madison, WI, USA). As a control, the reporter plasmid was co-transfected with empty vector [JDS70 (200 ng) and JDS 78 (200 ng)]. Medium was changed after 4 h incubation and replaced with complete medium with or without mirin (Sigma Aldrich, St. Louis, MO, USA; 100 μM). After 48 h, cells were tested for mCherry and GFP fluorescence by fluorescence microscopy and flow cytometry.

A total of 30,000 cells/well were seeded in 24 well-plates. After overnight incubation, XPA wildtype and CRISPR-rendered cells were transfected with non-irradiated renilla plasmid 50 ng/well (as transfection control), and either with non-irradiated or UVC-irradiated (1000 J/m²) firefly plasmid 250 ng/well using FuGene HD, according to the manufacturer’s protocol. After 48 h incubation, cell lysis, transfer to 96 well-plates and luminescence measurement using GloMax were performed according to the Dual-Luciferase Reporter Assay System protocol (Luciferase plasmids, Luciferase assay agents, transfection reagent and GloMax all from Promega, Madison, WI, USA). DNA repair capacities were determined by first calculating firefly to renilla luminescence ratios and then dividing irradiated to non-irradiated measurements. Finally, all calculated repair capacities were set in relation to those of A375 XPA wildtype (set as value 1).

HEK293T cells were seeded
in a six-well plate at 8 × 10⁵ cells/well in 2 mL
of Dulbecco’s modified Eagle’s medium (DMEM) supplemented
with 10% fetal bovine serum (FBS), penicillin (100 U/mL), and streptomycin
(100 μg/mL) and transfected 4 h after seeding using an X-tremeGENE
HP transfection reagent, following the manufacturer’s instructions
with a total of 2 μg of plasmid constructs (pGL4 NF-κB-FLuc
(NF-κB reporter Firefly luciferase, Promega), RIPK (Addgene
#78842), pGL4 TK-RLuc (Renilla luciferase driven by a TK promoter,
Promega)) for normalization, full-length USP21 (cloned into pcDNA3.1,
Myc-tagged) or USP21-C221R mutant (mutagenized USP21 in pcDNA3.1,
Myc-tagged), or pCDNA3.1 empty vector for no USP21 controls. Twenty
hours after transfection, cells were replated at 2 × 10⁵ cells/well in 100 μL in 96-well white plates (white, 6555098,
Greiner Bio-One). Four hours after replating, cells were treated with
compounds or DMSO (note: DMSO concentrations were kept consistent
across all cells). Promega Dual-Luciferase Reporter Assay kit was
then used to prepare samples for Firefly and Renilla signal measurement
on a CLARIOstar microplate reader (BMG) 20 h after compound treatment.
Relative luciferase units were calculated by normalizing the Firefly
signal to the background Renilla signal, followed by normalization
to DMSO controls of wild-type USP21.

CRISPR‐mediated knockout (KO) of the IDH1 gene was achieved by designing a guide RNA (gRNA) (guide sequence: GATCCTTGGTGACTTGGTCGT) based on the computation of genomic coordinates of IDH1 exon 4 using the CRISPOR tool [28 (link)]. The DNA sequence of this gRNA was then cloned into the eSpCas9_G2 plasmid as previously published [29 (link)] (Addgene plasmid # 86612; Watertown, MA, USA). Sequences were validated with Sanger sequencing (forward: TCCCCATAAGCATGACGACC; reverse: CTCCCACCACTTCAACGTCA) at the CHU de Québec‐Université Laval Research Center. The day before transfection, 500 000 22Rv1 cells per well were plated in a six‐well plate. Cells were transfected with 600 ng of the construct using the FuGENE HD Transfection Reagent (Promega, Fitchburg, WI, USA) according to the manufacturer's instructions at a ratio of 0.3 μL Transfection Reagent: 100 ng DNA per well. Seventy‐two hours after transfection, 0.5 μg·mL⁻¹ of ouabain was added to the culture media for selection. Single clones were then isolated in 96‐well plates after selection and amplified. Finally, clones were screened, and KO was confirmed by Sanger sequencing and western blots.