In our research laboratory, TaqMan Copy Number Assays (ABI) using qPCR were performed to quantify copy number of 10 genes that are within the CNV regions identified by CMA, including ABI probes for TAAR6 (Hs01574669_cn), EXOC4 (Hs04934540_cn), XRCC6P5 (Hs04097838_cn), AGTR2 (Hs00069365_cn), IMMP2L (Hs03623618_cn), TMEM131 (Hs03406682_cn), DST (Hs068118310_cn), SYNE1 (Hs01157475_cn) or a SYBR based assay for BRCA1 (F: 5’ AAGGCAACTTATTGCAGGTGA 3’ ; R: 5’ TTTTAAAAAGAGAGAAACATCAATCC 3’ ), and MYLK (F: 5’CCCGTGACATGTGTGATTTC 3’ ; R: 5’ CGTTATTGGGAGGTCTGAGG 3’ ). For TaqMan assays, a 20uL reaction containing 8ng genomic DNA, FAM dye-labeled target gene probe, VIC-TAMRA dye-labeled reference gene (Human RNaseP, ThermoFisher #4403326) and TaqMan Genotyping Master Mix (ThermoFisher #4371355) was amplified on the CFX-Connect Real Time System (BioRad) using the following PCR protocol: 95º for 10 min followed by 40 cycles of 95º for 15 seconds and 60º for 1 minute. All DNA samples were run in triplicate to account for technical error. All 8 PBS patients with the novel 10 CNVs were validated by qPCR. Controls included the PBS patient with the identified CNV (positive), a PBS patient with a normal CMA report (negative) and water (blank). The delta-delta CT method was used to obtain copy number values.
Human rnasep
Manufactured by Thermo Fisher Scientific
Human RNaseP is a ribonuclease enzyme that plays a key role in the processing of precursor transfer RNA (tRNA) molecules. It is responsible for cleaving the 5' leader sequence from the pre-tRNA, an essential step in the maturation of tRNA.
Automatically generated - may contain errors
Lab products found in correlation
Cfx connect real time system, by Bio-Rad (1 mentions)
Taqman genotyping master mix, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions)
Taqman copy number assay, by Thermo Fisher Scientific (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
2 protocols using human rnasep
1
Validating CNV regions by qPCR
2
Quantitative PCR Analysis of Genomic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative PCR analysis was carried out using TaqMan Gene Expression Master Mix and TaqMan Copy Number Assays on a 7900HT Fast Real Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). TaqMan Copy Number Assays used for DDR2, ERBB3, NTRK1, FGFR3, ROS1, and IGF1R were Hs01066084_cn, Hs02182510_cn, Hs00946894_cn, Hs00136087_cn, Hs02890670_cn, and Hs02543373_cn (Thermo Fisher Scientific), respectively. The TaqMan Copy Number Reference Assay, human RNase P (Thermo Fisher Scientific), was used as a control. Genomic DNA (10 ng) was used as template for each PCR amplification.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!