Anti phosphorylated stat3

Total protein was extracted from the aortas and cells and then detected with a BCA Protein Assay kit (Thermo Fisher Scientific). Protein samples (20 μg) were separated by electrophoresis on 8% Laemmli sodium dodecyl sulphate polyacrylamide gels. Equal amounts of protein per lane were electrophoretically transferred onto Immobilon‐FL PVDF membranes (Millipore). Then, the membranes were blocked with 5% non‐fat milk and incubated with anti‐STAT3 (1:1000; Cell Signaling Technology), anti‐phosphorylated STAT3 (1:2000; Cell Signaling Technology) and anti‐GAPDH antibodies at 4°C overnight followed by incubation with a goat antimouse IgG HRP‐conjugated secondary antibody (1:5000, Abcam) at room temperature for 1 hour. The blots were visualized using a 2‐colour infrared imaging system (Odyssey; LI‐COR Biosciences).

Chromatin Immunoprecipitation assays were performed following the manufacturer’s protocol (Sigma, 17-10086). HepG2 cells were stimulated with 50 ng/ml IL-6 in complete media (10%FBS-EMEM) for 16 h before proteins were cross-linked with 1% (final) formaldehyde for 10 min at room temperature. Cell lysates were sonicated using a standard probe sonicator for 4 × 15 s with 45 s intervals at 10 microns amplitude to generate chromatin fragments with an average size of 100–600 bp. Immunoprecipitation binding reactions were performed using the following antibodies: anti-RNA polymerase II (Cell Signalling, 13546) and anti-phosphorylated STAT3 (Cell Signalling, 9145). 1 μg of normal rabbit IgG (Cell Signalling, 2729) was used as a negative control and 5% of chromatin was used as input material. Immunoprecipitated DNA was amplified by RT-qPCR using primers specific for the human LRG1 promoter (forward primer: AATCAGGAAGCAAGGAAAGA, reverse primer: CCGTCCAGTTCCTGATAGG) and the data were analysed using the ΔΔCt method. Data are presented as fold-enrichment to IgG.

Proteins were extracted from the hearts of Il13ra1^−/− and WT mice or H9C2 cells using a RIPA buffer (Sigma‐Aldrich, St. Louis, MO) supplemented with Complete Mini, EDTA‐free, protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN, catalog number: 11 836 170 001). Following separation on an SDS‐PAGE, proteins were transferred to a nitrocellulose membrane using the iBlot Dry Blotting System (Invitrogen Corporation, Carlsbad, CA). Membranes were stained with a primary antibody overnight at 4°C, washed, and incubated with the appropriate secondary antibody for 45 to 60 minutes at room temperature. Specific reactive bands were detected using the SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific, Rockford, IL). The antibodies used were anti–signal transducer and activator of the transcription (STAT)3 (Cell Signaling Technology, Beverly, MA, catalog number 9139), anti‐STAT6 (Cell Signaling Technology, Beverly, MA, catalog number 5397), anti–phosphorylated STAT3 (Cell Signaling Technology, Beverly, MA, catalog number 9145), anti–phosphorylated STAT6 (Santa Cruz Biotechnology, Dallas, TX, catalog number sc‐11762‐R), anti‐actin (Santa Cruz Biotechnology, Dallas, TX, catalog number sc‐58670), and anti–α tubulin (Sigma‐Aldrich, Saint Louis, MO, catalog number T9026).

Western blotting was performed as previously described (Liu et al., 2018 (link)). Briefly, cells were lysed in Laemmli sample buffer (cat# 161–0737, Bio-Rad) before SDS–PAGE. Primary antibodies used for western blotting were as follows: anti-FUNDC1 (home-made) (Liu et al., 2012a (link)), anti-LC3 (cat# L8918, Sigma), anti-TIMM23 (cat# 611222, Biosciences), anti-TOMM20 (cat# 612278, Biosciences), anti-STAT3 (cat# 9139, Cell Signaling Technology), anti-phosphorylated STAT3 (cat# 9134, Cell Signaling Technology), anti-STAT5 (cat# 94205, Cell Signaling Technology), anti-phosphorylated STAT5 (cat# 4322, Cell Signaling Technology), anti-HIF2α (cat# NB100-122, Novus Biologicals), anti-βACTIN (cat# 8H10D10, Cell Signaling Technology), and anti-αTUBULIN (cat# ab52866, Abcam). Horseradish peroxidase-conjugated secondary antibodies were used, and signals were detected using an ECL kit (cat# WP20005, Invitrogen).

Western blotting was performed as previously described [22 (link)]. Anti-RAGE (1:1000, #6996S; Cell Signaling Technology, Inc., MA, USA), anti-STAT3 (1:1000, #12640; Cell Signaling Technology, Inc., MA, USA), anti-phosphorylated STAT3 (1:2000, #9145; Cell Signaling Technology, Inc., MA, USA), anti-cleaved caspase 3 (1:1000, #9664; Cell Signaling Technology, Inc., MA, USA), anti-LC3II/I (1:1000, #4108; Cell Signaling Technology, Inc., MA, USA), anti-Beclin1 (1:1000, #3495; Cell Signaling Technology, Inc., MA, USA) and anti-GADPH (1:1000, #2118; Cell Signaling Technology, Inc., MA, USA) were used as primary antibodies. The membranes were incubated with primary antibodies at 4℃ overnight, followed by incubation with HRP‐conjugated secondary antirabbit antibody (1:50,000; cat. no. BM2006; BOSTER Biological Technology Co., Ltd., Wuhan, Hubei, China) at 37 °C for 1 h after washing. anti-GADPH was used as an endogenous control for other proteins. Images were obtained using a chemiluminescent western blot scanner.