Mouse MC3T3-E1 cells line (Chinese Academy of Medical Sciences), antimicrobial peptides DP7 (State Key Biological Laboratory of Sichuan University), minimum essential medium (Gibco, America), alizarin red (Shanghai Sinopharm Group Co. LTD), TNF-α (Peprotech), Annexin V-FITC/PI Apoptosis Detection Kit (Miltenyi, Germany), CellTiter96® Aqueous One Solution Cell Proliferation Assay Kit (Promega), Real-time PCR Assay Kit (TaKaRa), Anti-phospho-MAPK (Cell signaling, America), BCA Protein Assay Kit (Beyotime). Inverted microscope (Olympus, Japan), Real-time PCR Detection System (Bio-Rad, America), fluorescence microscopy (Nikon, Japan), Gel electrophoresis system (Bio-Rad).
Real time pcr assay kit
Manufactured by Takara Bio
The Real-time PCR Assay Kit is a laboratory equipment designed for the amplification and detection of specific DNA sequences using the real-time PCR technique. It enables the quantitative analysis of target DNA or RNA molecules in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy kit, by Sangon (2 mentions)
Gel electrophoresis system, by Bio-Rad (1 mentions)
Fluorescence microscopy, by Nikon (1 mentions)
Annexin 5 fitc pi apoptosis detection kit, by Miltenyi Biotec (1 mentions)
Tnf α, by Thermo Fisher Scientific (1 mentions)
Real time pcr detection system, by Bio-Rad (1 mentions)
Bca protein assay kit, by Beyotime (1 mentions)
Celltiter 96 aqueous one solution cell proliferation assay kit, by Promega (1 mentions)
Inverted microscope, by Olympus (1 mentions)
Rabbit anti nephrin antibody, by Abcam (1 mentions)
Mouse anti β actin antibody, by Bioworld Technology (1 mentions)
Streptozotocin (stz), by Merck Group (1 mentions)
Total rna kit, by Tiangen Biotech (1 mentions)
4 protocols using real time pcr assay kit
1
Mouse Osteoblast Differentiation Assay
2
Quantitative PD-L1 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by RNeasy kit (Sangon Biotech) and assayed using a Real‐Time PCR assay kit (Takara). The relative mRNA expression level was normalized against β‐actin. The fold change over control was determined according to the ΔCt method. The PD‐L1 primers used were forward 5‐ATGGAG AGGAAGACCTGAAGGTTCA‐3 and reverse 5′‐GGGGCATTGACTTTCACAGTAATTCGC‐3′, and the β‐actin primers were forward: 5′‐GGTGGGCATGGGTCAGAAGGAT‐3′ and reverse 5′‐CACACGCAGCTC ATTGTAGAAGGT‐3′.
3
Investigating Renal Tubule PPAR-gamma Knockout
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL wild-type mice and C57BL renal tubule conditional PPARγ gene knockout mice (SPF grade), with a body weight of 30 ± 5 g, were self-bred and identified (Professor Guan Youfei of Peking University Health Science Center presented a rat as a gift, SYXK (Beijing) 2011-0012). The following are the main materials and reagents: streptozotocin (STZ; SIGMA company); two-step immunohistochemistry detection reagent, horseradish peroxidase-labeled sheep anti-rabbit IgG, and DAB coloration kit (ZSGB Bio Co., Beijing); bicinchoninic acid protein concentration determination kit and ECL chromogenic agent (Beyotime Biotechnology, Beijing); prestained marker (Thermo Fisher Scientific); mouse anti-β-actin antibody (Bioworld, Nanjing); rabbit anti-PPARγ antibody, rabbit anti-NPHS2 antibody, and rabbit anti-collagen-IV antibody (Proteintech); rabbit antinephrin antibody (Abcam); total RNA kit (TIANGEN Biochemical Technology Co., Beijing); real-time PCR assay kit (TaKaRa); and light microscopy and transmission electron microscopy (Precise, Beijing).
4
RNA Expression Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNeasy kit (Sangon Biotech) and assayed by using Real-Time PCR assay kit (Takara). mRNA expression was normalized against GAPDH. Fold change over control was determined according to the Ct method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!