The largest database of trusted experimental protocols

5 protocols using sh snhg1

1

Lentiviral Knockdown and Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviruses expressing specific targeted knockdown SNHG1 [short hairpin-SNHG1 (sh-SNHG1)] and MDM2 (sh-MDM2) sequences and a scramble shRNA (sh-NC; control shRNA) were constructed by GenePharma (Shanghai, China) (Table 2). Lentiviruses overexpressing SNHG1 (oe-SNHG1), MDM2 (oe-MDM2), and PPARγ (oe-PPARγ), oe-NC, Inhibitor NC, and miR-9-3p inhibitor were obtained from GenePharma. Transfection was implemented using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA).
+ Open protocol
+ Expand
2

Genetic Modulation of SNHG1, FOXP2, and KDM5B

Check if the same lab product or an alternative is used in the 5 most similar protocols
Short-hairpin RNA directed against human SNHG1, FOXP2 and KDM5B was constructed in pGPU6/GFP/Neo vector (sh-SNHG1, sh-FOXP2 and sh-KDM5B), their respective non-targeting sequence (negative control, NC) were also synthesized (GenePharma, Shanghai, China). FOXP2 full length with and without 3’UTR plasmids and their non-targeting sequence (negative control, NC) were synthesized (GenScript, Piscataway, NJ, USA). U87 and U251 cells was transfected at about 70–80% confluency in 24-wells plates using Lipofectamine 3000 reagents (Invitrogen, CA, USA) according to the manufacturer’s instructions. Stable transfected cells were obtained by continuous application of Geneticin (G418, Invitrogen, CA, USA) and evaluated for their over-expression and silence efficiencies by qRT-PCR.
The oligonucleotide sequences of human miR-154-5p and miR-376b-3p mimics, as well as miR-154-5p and miR-376b-3p inhibitors were synthesized (GenePharma, Shanghai, China). A scrambled sequence was used as the negative control. Furthermore, miR-376b-3p + 44 A to I editing mimics were synthesized (GenePharma, Shanghai, China). Cells were transfected using Lipofectamine 3000 reagent (Invitrogen, CA, USA). The transfected efficacy was evaluated by qRT-PCR, and the high transfection efficacy of these could sustain 7 days from 48 h post-transfection.
+ Open protocol
+ Expand
3

Knockdown of SNHG1 and LMNB2 in Huh7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentivirus vectors (sh-SNHG1, sh-LMNB2) and small interfering RNAs (siRNAs) against human SNHG1 or LMNB2 were synthesized by GenePharma Co. Ltd. The stable Huh7 cells with SNHG1 and LMNB2 knocked down were generated using lentiviral vectors. Infected cells were then treated with puromycin (2 µg/ml) for 2 days, and surviving cells were maintained in complete medium with puromycin (0.5 µg/ml). The siRNAs were transfected into hepatocellular cancer cells using Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) according to their instructions. Besides, miR-326 mimics, miR-326 inhibitors, and negative controls were purchased from GenePharma Co. Ltd. When the cell confluence reached 50%, oligonucleotide transfection was performed using Lipofectamine 2000 according to the manufacturer’s protocol.
+ Open protocol
+ Expand
4

Lentiviral Knockdown of SNHG1 and miR-101 Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentiviruses carrying shRNA against SNHG1 (sh-SNHG1) or scrambled shRNA (sh-NC) or were purchased from GenePharma Co., Ltd (Shanghai, China). The sequence of sh-SNHG1 was: GGTTTGCTGTGTATCACATTTCTCGAGAAATGTGATACACAACCTTTT (Xu et al., 2018 (link)). miR-101 inhibitor and negative control (NC) were obtained from RiboBio Co., Ltd (Guangzhou, China). The lentiviruses were transduced using polybrene (GenePharma Co., Ltd), and the miR-101 mimic, inhibitor and the corresponding NC were transfected using lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions.
+ Open protocol
+ Expand
5

Lentiviral Knockdown and Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviruses expressing speci c targeted knockdown SNHG1 [short hairpin-SNHG1 (sh-SNHG1)] and MDM2 (sh-MDM2) sequences and a scramble shRNA (sh-NC; control shRNA) were constructed by GenePharma (Shanghai, China) (Table 2). Lentiviruses overexpressing SNHG1 (oe-SNHG1), MDM2 (oe-MDM2), and PPARγ (oe-PPARγ), oe-NC, Inhibitor NC, and miR-9-3p inhibitor were obtained from GenePharma. Transfection was implemented using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!