The coding sequence for human Olig2 was chemically synthesized (Tsingke, Beijing, China) and cloning it into pCMV-N-Flag expression vector. The CD133 promoter sequences were predicted (https://dbtss.hgc.jp/ ), synthesized, and cloned into pGL3-basic vector. siRNA targeting Olig2 was purchased from RiboBio (Guangzhou, China). And the siRNA target sequence for Olig2 knockdown was: 5′-GCATGCACGACCTCAACAT-3′. A549 or NCI-H820 cells were seeded into 6-well plates at the concentration of 3 × 105/well and incubated at 37 °C overnight. Lipo2000 (Invitrogen, #11668-019, USA) was used to transfect vectors or siRNA into cells. After transfected for 48 hours, the cells were collected for further analysis.
Sirna targeting
Manufactured by RiboBio
Sourced in China
SiRNA targeting is a laboratory technique used to selectively silence the expression of specific genes. It involves the use of small interfering RNA (siRNA) molecules that bind to and degrade the target messenger RNA (mRNA), preventing the production of the corresponding protein.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions)
Lentiviral packaging kit, by Genechem (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Lipo2000, by Thermo Fisher Scientific (1 mentions)
Arpe 19, by American Type Culture Collection (1 mentions)
So rb50, by American Type Culture Collection (1 mentions)
Mirna inhibitor, by RiboBio (1 mentions)
Liposome lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by MedChemExpress (1 mentions)
Si nc, by RiboBio (1 mentions)
Hepg2, by National Collection of Authenticated Cell Cultures (1 mentions)
Hep3b, by National Collection of Authenticated Cell Cultures (1 mentions)
Nc sirna, by RiboBio (1 mentions)
Recombinant lentivirus, by Genechem (1 mentions)
Puromycin, by Merck Group (1 mentions)
Control sirna, by RiboBio (1 mentions)
Sirna control duplexes, by RiboBio (1 mentions)
Quickchange primer design, by Agilent Technologies (1 mentions)
Pezx fr02, by GeneCopoeia (1 mentions)
13 protocols using sirna targeting
1
Olig2 Expression and Knockdown
2
Knocking Down IFT88 in ATDC5 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ATDC5 progenitor chondrocytic cells were transfected with 100 nM siRNA targeting IFT88 or a negative control siRNA (Guangzhou RiboBio Co., Ltd., Guangzhou, China), using a standard protocol. Knockdown efficiency was evaluated by western blotting.
3
Investigating HEIH and miR-194-5p in Retinal Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human normal retinal epithelial cell line ARPE-19 and retinoblastoma cell lines (Y79 and SO-Rb50) were purchased from ATCC and maintained in RPMI-1640 medium supplemented with 10% FBS at 37°C in 5% CO2. si-RNA targeting HEIH, and corresponding negative control si-NC, miR-194-5p mimics, inhibitor and negative control, WEE1 overexpressing vector pcDNA3.1-WEE1 and negative control pcDNA3.1 were supplied by RiboBio (Guangzhou, China). Cells were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. At 48 h transfection, the cells were harvested for functional analysis.
4
miR-181a Inhibitor and Gene Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miR-181a inhibitor (2′-Omethyl-modified antisense oligonucleotides specifically targeting mature miR-181a), miRNA inhibitor negative control, siRNA targeting FoxO1 (human, 5′-GGACAACAACAGUAAAUUUdTdT-3′ mouse, 5′-CCGCCAAACACCAGUCUAAdTdT-3′), siRNA targeting SIRT1 (human, 5′-GCUAAGAAUUUCAGGAUUAdTdT-3′ mouse, 5′-CCAUGAAGUGCCUCAAAUAdTdT-3′), and siRNA negative control were all synthesized by Ribobio (Guangzhou, China). For loss-of-function experiments, these oligonucleotides were transfected into GCs using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Neither the miRNA inhibitor negative control nor the siRNA negative control shared homologous regions with the human or mouse genome sequences.
5
Lentiviral Knockdown of SNHG22 in Gastric Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus carrying sh-SNHG22 or sh-ctrl was packaged in human embryonic kidney 293 T cells using the lentiviral packaging kit purchased from Genechem (Shanghai, China). Stable cell lines were established by infecting BGC-823 and MGC-803 cells with lentivirus followed by puromycin selection. siRNA targeting ELK4, miR-200c-3p mimics and anti-miR-200c-3p were designed and synthesized by RiboBio (Guangzhou, China).
6
Cannabinoid Receptor 2 Modulation in Hepatocellular Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCC cell lines, Hep3B and HepG2, were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), and cultured in DMEM (HyClone, Logan, UT) medium supplemented with 10% fetal bovine serum (FBS, GibcoBRL; Grand Island, NY, USA) at 37 °C with 5% CO2. MDA19 (Cat# HY-15451, MedChemExpress, USA) was dissolved in DMSO and then diluted with DMEM to a specific concentration to incubate with HCC cells. siRNA targeting CB2 and a negative control siRNA (siNC) were synthesized by Guangzhou RiboBio Co., Ltd. and transfected into HCC cells by using Lipofectamine2000 liposomes (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The sequences of siRNAs were as follows:
CB2 siRNA1: 5′-CCAGGTCAAGAAGGCCTTT-3′;
CB2 siRNA2: 5′- GCTTGGATTCCAACCCTAT-3′;
CB2 siRNA3: 5′-CCTGGCCAGTGTGGTCTTT-3′;
siNC: 5′-UUCUCCGAACGUGUCACGUTT-3.
CB2 siRNA1: 5′-CCAGGTCAAGAAGGCCTTT-3′;
CB2 siRNA2: 5′- GCTTGGATTCCAACCCTAT-3′;
CB2 siRNA3: 5′-CCTGGCCAGTGTGGTCTTT-3′;
siNC: 5′-UUCUCCGAACGUGUCACGUTT-3.
7
Silencing NONRATT010788.2 in Rat Hippocampal Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The rat hippocampal neurons were purchased from JENNIO Bio. Tec. and maintained in a humidified atmosphere (Thermo Fisher) containing 5%CO2 at 37°C. The Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (Gibco) was used for neuron cell culture. SiRNA targeting NONRATT010788.2 and siRNA‐NC (RiboBio Tech.) were transfected with fiboFECT CP Transfection kit (RiboBio Tech.) following the manufacturer's protocol. At 48 hours after transfection, the cells were collected for total RNA extraction and related assay. All transfections were performed in triplicate.
8
AFAP1-AS1 Knockdown and Overexpression Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the knockdown experiments, siRNA targeting AFAP1-AS1 RNA (5’-AACACCAATCCCAAGAGGT GA-3’) and siRNA control (5’-TTCTCCGAACGTGT CACGT-3’) duplexes were purchased from the RiboBio, Guangzhou, China. Recombinant lentiviruses containing AFAP1-AS1(GenBank access number: NR_026892.1) expressing AFAP1-AS1-shRNA and AFAP1-AS1-specific cDNA were purchased from Genechem Co., Ltd (Shanghai, China). The GV248 vector (hU6MCS-Ubiquitin-EGFP-IRES-puromycin) used for the stable expression of shRNA against AFAP1-AS1 and a fluorescent marker (GFP-RFP fusion protein) contained a puromycin resistance gene. The negative control (NC) sequence was indicated as “NC” and had no homology to any human genomic sequences. Lenti-viral transfection was conducted according to the GenePharma Recombinant Lentivirus Operation Manual (http://www.genepharma.com ). HuCCT1 and TFK-1 cells (1 × 105 cells/well) were seeded into 6-well plates for 24 hours, and after the addition of polybrene (8 μg/ml), the cells were infected with 2 μl of concentrated lentivirus for 72 hours. Cells were selected for 2 weeks with the addition of puromycin (5μg/ml, Sigma-Aldrich, St, Louis, USA) to generate stablem-onoclonal cell lines. Cells were selected for 2 weeks by the addition of puromycin to generate stable monoclonal cell lines. The expression of AFAP1-AS1 was confirmed by qRT-PCR.
9
Autophagy Regulation in Pancreatic Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mia PaCa-2 and Panc-1 cells were grown in 6-well plates and transfected with 50 nM siRNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. siRNA targeting Atg5 mRNA (AGUGAACAUCUGAGCUACCCGGAUA) and siRNA control duplexes were purchased from RiboBio company (Guangzhou, China).
10
Targeted silencing and overexpression of UPF1 and AREG
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A short hairpin RNA (shRNA) sequence specifically targeting UPF1 (Table SIV) was cloned into Phblv-U6-puro (provided by Professor Fan Handong, Hangzhou Normal University) by BamHI and EcoRI digestion. The siRNA targeting AREG (targeted sequence, CCACAAATACCTGGCTATA) and a scrambled sequence were purchased from Guangzhou RiboBio Co., Ltd. The UPF1 insA and UPF1 del plasmids were constructed based on the pCMV-MYC-UPF1 vector (provided by Professor Lynne E. Maquat, University of Rochester). Primers for site-directed mutagenesis (Table SIV) were designed by QuickChange Primer Design (Agilent Technologies, Inc.) and applied with the KOD-Plus-PCR enzyme (Toyobo Life Science). Residual templates were digested by DpnI (New England Biolabs, Inc.) at 37°C for 5 h. The AREG gene open reading frame (ORF) with or without the 3′ untranslated region (3′UTR), which was referred as AREG-3′UTR-pEGFP or AREG-ORF-pEGFP, respectively, was cloned into the pEGFP-N1 vector (provided by Dr Wang Miao, Hangzhou Normal University) using the HindIII and BamHI restriction sites. The primer sequences used are listed in Table SIV. The AREG 3′UTR sequence was amplified and cloned into the dual-luciferase reporter construct pEZX-FR02 (GeneCopoeia, Inc.) by double digestion with EcoRI and SpeI (the primer sequences used are listed in Table SIV) to generate the pEZX-AREG-3′UTR construct.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!