HEK293T knockout cell lines were generated by transient transfection of pSpCas9(BB)-2A-Puro (Addgene #48139) encoding U6 driven expression of sgRNAs (Scramble Guide: GCACTACCAGAGCTAACTCA; ATG7 Guide: ACACACTCGAGTCTTTCAAG; ATG12 Guide: CCGTCTTCCGCTGCAGTTTC; ATG14 Guide: CTACTTCGACGGCCGCGACC; FIP200 Guide: AGAGTGTGTACCTACAGTGC). Cells were selected 48–72 hours post-transfection with 1μg/ml puromycin for 48 h. Polyclonal populations were collected for Surveyor analysis (IDT, 706020) and were sorted into single-cell populations by limiting dilution at 1.5 cells/well per 96-well plate. For DNA analysis, genomic DNA samples were prepared using QuickExtract (Epicentre). The PCR products were column purified and analysed with Surveyor Mutation Detection Kit (IDT). For genotyping of single-sorted cells, PCR amplified products encompassing the edited region (ATG7 Fw: TGGGGGACAGTAGAACAGCA, ATG7 Rev: CCTGGATGTCCTCTCCCTGA; ATG12 Fw: AGCCGGGAACACCAAGTTT, ATG12 Rev: GTGGCAGCCAAGTATCAGGC; ATG14 Fw: AAAATCCCACGTGACTGGCT, ATG14 Rev: AATGGCAGCAACGGGAAAAC; FIP200 Fw: ATTCTCTGGCTTGACAGGACAG, FIP200 Rev: AAATACTGAGCGTGCACATTGC) were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher #450030) and sequence verified. Sequencing is available upon request.
Pcr4 topo ta
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PCR4-TOPO-TA is a laboratory product designed for the direct cloning of Taq polymerase-amplified PCR products. It provides a convenient system for the insertion and propagation of PCR fragments in Escherichia coli.
Automatically generated - may contain errors
Lab products found in correlation
Topo ta cloning kit, by Thermo Fisher Scientific (2 mentions)
Pspcas9 bb 2a puro, by Addgene (2 mentions)
Quickextract, by Illumina (2 mentions)
Sanger sequencing, by Genewiz (1 mentions)
Instaclone pcr cloning kit, by Thermo Fisher Scientific (1 mentions)
Wizard plus sv miniprep, by Promega (1 mentions)
Minielute gel extraction kit, by Qiagen (1 mentions)
Pcr2.1 topo ta, by Thermo Fisher Scientific (1 mentions)
Qiamp dna mini kit, by Qiagen (1 mentions)
Onestep rt pcr kit, by Qiagen (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Qiaprep spin miniprep kit, by Qiagen (1 mentions)
10 protocols using pcr4 topo ta
1
Generation of Genetically Engineered HEK293T Cells
2
Genomic DNA Extraction and Mutagenesis Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from 24 hpf embryos was extracted and tested as previously described [31 (link)]. Briefly, embryos were lysed with 50 mm NaOH at 95°C for 25 min to obtain PCR templates. DNA surrounding the otpa and otpb sgRNA regions was amplified and sequenced. To confirm the frequency of mutagenesis, the targeted DNA regions in F0 founders were cloned into pCR4-TOPO TA (ThermoFisher). Plasmids were isolated from individual colonies and Sanger sequencing was performed (Genewiz, Inc).
3
Generation of Genetically Engineered HEK293T Cells
4
Adenovirus qRT-PCR Protocol for ONCOS-102
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA isolation for qRT-PCR was done using a Kit for isolation of DNA from body fluids (Generi Biotech, Hradec Kralove, Chzech Republic) according to the manufacturer’s protocol. A specific adenovirus PCR product was prepared from the genomic DNA of ONCOS-102 and cloned to a plasmid pCR4 TOPO TA (Invitrogen, Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA) to be used as a positive control standard for the qRT-PCR assay. The qRT-PCR was done using primers Ad_dE1#1 CTATGCCAAAACCTTGTACCG and Ad_dE1#2 TCCTCACCCTCTTCATCCTC and probe Ad_E1#P TGATCGATCCACCCAGTGACGAC targeting the E1 gene, specifically the region with the 24 bp deletion. A traditional lambda phage-target specific internal amplification control (primers PhgL_Q2#1 AAAAAGGATGAATCGCTTGGTGTA and PhgL_Q2#2 AATCCTGAATTTTCGGTGATG and probe PhgL_Q2#PCCATCGTGCCGCGACTGC) was used to avoid false-negative results [73 (link)].
5
PCR Fragment Amplification and Verification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplified DNA fragments were obtained by PCR using the appropriate oligonucleotide combinations listed as online Supplementary Information (Table S2 ). These were synthesized by either DNA Technology A/S (Aarhus, Denmark), TAG Copenhagen A/S (Copenhagen, Denmark) or Sigma-Aldrich Sweden AB (Stockholm, Sweden). Amplified fragments were confirmed to be mutation free by first cloning into pCR®4-TOPO TA (Invitrogen AB, Stockholm, Sweden) or pTZ57R using the InsTAclone PCR cloning kit (Thermo Fisher Scientific, Gothenburg, Sweden) and then via commercial sequencing (Eurofins MWG Operon, Ebersberg, Germany or GATC Biotech AB, Solna, Sweden).
6
Identification of Malaria Parasite Genetic Diversity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The msp2 allelic repertoire was determined for a subset of samples from each site by amplifying genomic DNA using primer sets msp2F (5′- CTG CTT TAG GTA AGA TGA CTA AGR GTG ARG C- 3’) in combination with each of five reverse primer sets as previously described [9 (link)]. The amplicons were cloned into pCR4-TOPO-TA (Invitrogen) and plasmid DNA from 96 bacterial clones of each sample was extracted with Wizard plus SV minipreps (Promega). All inserts were sequenced in both directions as described above. The sequences were edited using BioEdit software and analyzed with HyPhy 2.0 [19 ].
7
Purifying and Sequencing PCR Amplicons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR amplified bands were cut from gels and DNA purified using a mini-elute gel
extraction kit (Qiagen). Between 1–4 μl of eluted PCR product were
inserted into pCR4-TOPO-TA or pCR2.1-TOPO-TA (Invitrogen) and transformed into
TOP10 Chemically Competent Escherichia coli cells (Invitrogen).
Plasmids containing an insert of the correct size were sequenced using M13 forward
or reverse primers. Sequences were aligned to the Ictidomys
tridecemlineatus genome using BLASTN or BLAT in Ensembl.
extraction kit (Qiagen). Between 1–4 μl of eluted PCR product were
inserted into pCR4-TOPO-TA or pCR2.1-TOPO-TA (Invitrogen) and transformed into
TOP10 Chemically Competent Escherichia coli cells (Invitrogen).
Plasmids containing an insert of the correct size were sequenced using M13 forward
or reverse primers. Sequences were aligned to the Ictidomys
tridecemlineatus genome using BLASTN or BLAT in Ensembl.
8
Temporal HIV-1 Sequence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HIV-1 RNAs were extracted from plasma on time points of seroconversion, 3 and 6 months after HIV-1 infection, and then were cloned into pCR™4-TOPO® TA vector through the TA TOPO cloning kit (Invitrogen, Carlsbad, CA). Expected 20 colonies were constructed from each sample, and HIV-1 gag and pol genes were amplified and sequenced by Beijing Institute of Genomics, Shenzhen, China.
9
Pig Cell Genomic DNA and RNA Isolation
10
TA Cloning and Sequencing of PCR Product
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cloning was carried out in the pCR™ 4-TOPO® TA cloning maintenance vector (Invitrogen, Waltham, MA, USA) following the manufacturer's instructions. Subsequently, DH5α cells (E. coli TOP 10) were transformed, and the transformed cells were plated in petri dish with LB-ampicillin medium (100 mg/ml), incubated at 37°C for 18 h. As a control, the transformation was carried out without the PCR product. Furthermore, ten bacteria colonies were selected and used for the isolation and purification of the plasmids containing the insert and were prepared for commercial sequencing. The cloning products were sequenced in both directions using each of the primers by the automated Sanger method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!