Viral RNA levels were determined in supernatants collected from HIV-1 infected cells at 5, 10, 15, 20, 30- and 40-days post-infection. Total RNA was isolated using the Viral RNA Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA reactions were performed according to the manufacturer’s instructions of the PrimeScript RT Reagent Kit (Takara) using primers specifically targeting the U6 and scaffold region (forward primer 5´-CCGACTCGGTGCCACTTTTT-3´, reverse primer 5´-CGTGACGTAGAAAGTAATAATTT-CTTGGG-3´). cDNA reactions were purified using the Monarch PCR Purification Kit (NEB #T1030L) and eluted in 10 µl elution buffer. The sgRNA cassette was amplified using the NEBNext® High-Fidelity 2X PCR Master Mix (NEB) and primers including Illumina adapters and 8nt barcodes to allow Next Generation Sequencing analysis (Supplementary Data 2 ). PCR reactions were purified using the Monarch PCR Purification Kit (NEB # T1030L) and eluted in 10 µl elution buffer.
Monarch pcr purification kit
Manufactured by New England Biolabs
The Monarch PCR & DNA Cleanup Kit is a fast and efficient method for purifying PCR products and other DNA fragments. It utilizes a silica-based spin column design to remove unwanted primers, nucleotides, enzymes, and other contaminants from DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Hifi assembly, by New England Biolabs (2 mentions)
Onetaq one step rt pcr kit, by New England Biolabs (1 mentions)
Qiaamp viral rna mini kit, by Qiagen (1 mentions)
Viral rna mini kit, by Qiagen (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Nebnext high fidelity 2x pcr master mix, by New England Biolabs (1 mentions)
Megaclear transcription clean up kit, by Thermo Fisher Scientific (1 mentions)
Purelink pcr purification kit, by Thermo Fisher Scientific (1 mentions)
7 protocols using monarch pcr purification kit
1
Quantifying Viral RNA Levels in HIV-1 Infection
2
Wolbachia Detection Using Nested PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prescreening for Wolbachia presence was first performed by nested PCR amplification of the Wolbachia-specific ftsZ (cell division) gene using the primer pair ftsZF3/R3 (5′-GCAAATACYGATGCTCARGC -3′ and 5′-ATCAATRCCAGTTGCAAGAA -3′), followed by ftsZF4/R4 (5′-CTAAGGGDCTTGGTGCTGGT -3′ and 5′-ACYTCTTCRCGCACTCTATT -3′). Four other genes were also amplified (dnaA, coxA, fbpA, and gatB), as described by Lefoulon et al. (24 (link)) (Table S2 in the supplemental material). For all PCRs, negative controls (no DNA) were also performed to rule out contamination artifacts. The PCR products were Sanger sequenced after purification using the NEB Monarch PCR purification kit. The sequences were analyzed by comparison with available sequences extracted from Wolbachia complete or draft genome sequences and the addition of sequences from Wolbachia from Zootermopsis angusticollis and Zootermopsis nevadensis (Table S3 in the supplemental material).
3
Wolbachia Detection Using Nested PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prescreening for Wolbachia presence was first performed by nested PCR amplification of the Wolbachia-specific ftsZ (cell division) gene using the primer pair ftsZF3/R3 (5′-GCAAATACYGATGCTCARGC -3′ and 5′-ATCAATRCCAGTTGCAAGAA -3′), followed by ftsZF4/R4 (5′-CTAAGGGDCTTGGTGCTGGT -3′ and 5′-ACYTCTTCRCGCACTCTATT -3′). Four other genes were also amplified (dnaA, coxA, fbpA, and gatB), as described by Lefoulon et al. (24 (link)) (Table S2 in the supplemental material). For all PCRs, negative controls (no DNA) were also performed to rule out contamination artifacts. The PCR products were Sanger sequenced after purification using the NEB Monarch PCR purification kit. The sequences were analyzed by comparison with available sequences extracted from Wolbachia complete or draft genome sequences and the addition of sequences from Wolbachia from Zootermopsis angusticollis and Zootermopsis nevadensis (Table S3 in the supplemental material).
4
Fluorescent DNA Synthesis and Purification
5
Fluorescent DNA Synthesis and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The fluorescent DNA containing 20 Ronin-binding motifs was synthetized by IDT and cloned into the pUC19 vector using HiFi Assembly (NEB).39 (link) Cy5-labeled M13(21) (/5Cy5/TGTAAAACGACGGCCAGT) and M13 reverse (/5Cy5/CAGGAAACAGCTATGAC) primers were used to amplify the synthetic DNA sequence by PCR, yielding a fluorescently labeled PCR product. The fluorescent PCR products were purified twice, first with the QIAGEN PCR purification kit and then with the NEB Monarch PCR purification kit.
6
Viral RNA Extraction and RT-PCR Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted from the virus stocks used in the infection experiments employing the QiaAMP viral RNA mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Subsequently, a one-step RT-PCR employing the primers Erns forward (NADL nt 1358–1379; CATGGTATGATGGATGCAAGTG) and Erns reverse (NADL nt 2018–2040; GACAAGTGACCTCCCATCTCATG) was performed with the OneTaq One-Step RT-PCR kit (NEB) according to the manufacturer’s instructions. The resulting PCR product was purified with the Monarch PCR purification kit (NEB) according to the manufactures instructions and sent for sequencing (Eurofins) with the primer R588.
7
Preparing riboregulator templates by PCR and in vitro transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA templates were prepared by PCR amplification of plasmids encoding for the RNA translational regulators, followed by affinity column purification using Monarch PCR Purification Kit (New England BioLabs) or PureLink PCR Purification Kit (Thermo Fisher Scientific). Primers used for PCR amplification contained a T7 promotor or a T7 terminator (Biomers). RNA templates were prepared by in vitro transcription followed by purification using MEGAclear Transcription Clean-Up Kit (Ambion). The DNA and RNA integrity was determined by a 2% agarose gel and the concentrations were determined by absorbance at 260 nm using a NanoDrop 2000 UV-Vis spectrophotometer. The sequences of the riboregulator domains (Table S1), of the PCR primers (Table S2) and of the plasmids are compiled in the SI.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!