HuH7, Caco-2, Calu-3, HuH7.5.1, VeroE6, HepG2, and HEK293T cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin (Thermo Fisher Scientific, Waltham MA). CRISPR constructs were generated by cloning an ACE2-targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the human ACE2 coding sequence (Sino Biological, Beijing China, #HG10108-M) into LeGO-iC2 (Addgene #27345, gifted by Boris Fehse) with simultaneous replacement of mCherry with a blasticidin resistance cassette. Lentivirus was generated and used to genetically engineer cell lines as previously described59 (link). Primers used for qRT-PCR were: ACE2-fwd [5′-AAACATACTGTGACCCCGCAT-3′], ACE2-rev [5′-CCAAGCCTCAGCATATTGAACA-3′], ACTB-fwd [5′-CCCTGGACTTCGAGCAAGAG-3′], ACTB-rev [5′-ACTCCATGCCCAGGAAGGAA].
Lego ic2
Manufactured by Addgene
Sourced in China
LeGO-iC2 is a plasmid vector designed for inducible gene expression. It contains a minimal cytomegalovirus (CMV) promoter that can be activated by the reverse tetracycline-controlled transactivator (rtTA) protein to drive expression of the gene of interest.
Automatically generated - may contain errors
Lab products found in correlation
Lego ig2, by Addgene (2 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Esp3i, by New England Biolabs (1 mentions)
Hifi dna assembly, by New England Biolabs (1 mentions)
Plenticrisprv2, by Addgene (1 mentions)
Gateway vector conversion system, by Thermo Fisher Scientific (1 mentions)
Pspax2, by Addgene (1 mentions)
Pmd2 g, by Addgene (1 mentions)
Jetprime, by Polyplus Transfection (1 mentions)
Interferin, by Polyplus Transfection (1 mentions)
Px330, by Addgene (1 mentions)
Lego g2 vector, by Addgene (1 mentions)
T4 ligase, by Thermo Fisher Scientific (1 mentions)
Q5 dna polymerase, by New England Biolabs (1 mentions)
6 protocols using lego ic2
1
SARS-CoV-2 Host Cell Receptor Engineering
2
Constitutive NICD Expression in OSCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To achieve constitutive expression of NICD, 3xFlagNICD1 (Addgene #20183, [55 (link)]) was cloned into the multiple cloning site, under the SFFV promoter, of the LeGO-iC2 plasmid (Addgene#27345, [56 (link)]) using the Gateway Vector Conversion System (ThermoFisher Scientific). The plasmids were kind gifts from Raphael Kopan and Boris Fehse, respectively. Lentivirus was produced by transfecting HEK293 with second generation packaging plasmids (psPAX2 - Addgene#12260, and pMD2.G-Addgene#12259) using JetPRIME® (Polyplus Transfection) according to the Manufacturer’s guidelines. OSCC cells were subsequently transduced with lentiviruses.
Transient transfection with SMARTpool ON-TARGETplus SERPINE1 (ID 118572, Thermo Fisher) and Silencer® Negative Control No. 1 (Thermo Fisher) siRNAs was carried out using INTERFERin® (Polyplus transfection).
Transient transfection with SMARTpool ON-TARGETplus SERPINE1 (ID 118572, Thermo Fisher) and Silencer® Negative Control No. 1 (Thermo Fisher) siRNAs was carried out using INTERFERin® (Polyplus transfection).
3
Generating gRNA-expressing plasmids using LeGO-CC vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
gRNA-expressing plasmids were generated by using a LeGO-CC vector containing the U6 promoter and gRNA scaffold, and synthesizing the respective DNA sequences (as indicated in Supplementary Table S1 ). If necessary, a “G” was adjoined at the 5′-end of the gRNA/spacer sequence, which is required for polymerase-III-dependent transcription. During synthesis, an ACC triplet and an AAC were added at the 5′ ends of the leading and the complementary strands, respectively, to allow for ligation into the SapI cloning site of the LeGO-CC vector (based on LeGO-iC2, Addgene #27345 [58 (link)]).
4
CRISPR-Cas9 LeGO Vectors Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All-in-one CRISPR-Cas9 “LeGO-CC” vectors were generated by cloning the humanized Streptococcus pyogenes Cas9 (SpCas9) gene behind the internal SFFV promotor and chimeric guide RNA (gRNA) scaffold from pX330 (Addgene #42230), a kind gift from Feng Zhang [17 (link)], behind the U6 promotor of LeGO-iG2 (Addgene #27341) and LeGO-iC2 (Addgene #27345) vectors [24 (link)]. To generate constructs that express the gRNAs of choice, the respective sequences with the addition of ACC at the 5′ end of the leading strand, followed by G, if necessary (required for polymerase-II dependent transcription), and AAC at 5′ end of complementary strand were synthesized. ACC/AAC were added to allow for cloning pre-annealed F/R-Alu-gRNA oligos into the SapI cloning site of the LeGO-iC2-CC and/or LeGO-iG2-CC vectors. Primer sequences are provided in Table S1 .
LeGO-eGFP-NLS-p53BPpuro+ vector was generated by cloning nls53BP1 from pcDNA-FRT/T0-eGFPnls-53BP1 1220-1631 WT (Addgene #60814) [25 (link)], a kind gift from Daniel Durocher, and 2Apuro from LeGO-iC2puro+ into the LeGO-G2 vector (Addgene #25917) [24 (link)] using the restriction site BsrGI. Primer sequences and cloning details are provided inTable S1 .
LeGO-eGFP-NLS-p53BPpuro+ vector was generated by cloning nls53BP1 from pcDNA-FRT/T0-eGFPnls-53BP1 1220-1631 WT (Addgene #60814) [25 (link)], a kind gift from Daniel Durocher, and 2Apuro from LeGO-iC2puro+ into the LeGO-G2 vector (Addgene #25917) [24 (link)] using the restriction site BsrGI. Primer sequences and cloning details are provided in
5
Lentiviral Transduction of Mouse PDK4
6
All-in-one CRISPR/Cas9 Vector Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All-in-one CRISPR/Cas9 LeGO (“LeGO-CC”) vectors51 were generated by cloning human codon-optimized Streptococcus pyogenes Cas9 gene (SpCas9) containing Nuclear Localization Signal and chimeric gRNA scaffold under hU6 promotor from pX330 (3, Addgene #42230), a kind gift from the Feng Zhang lab, into LeGO-iG2 (Addgene #27341) and LeGO-iC2 (Addgene #27345) vectors.52 (link),53 (link) To generate constructs that express the gRNAs of choice, the respective sequences with addition of ACC at the 5′ end of the leading strand, followed by G if necessary (required for polymerase III dependent transcription) and AAC at 5′ end of complementary strand, were synthetized. ACC/AAC were added to allow for cloning into the SapI cloning site of LeGO-CC-iC2 or LeGO-CC-iG2 vectors.
To obtain the K855A and e1.0 (K810A/K1003A/R1060A) Cas9 variants, suitable primers were designed to introduce the desired mutations by PCR with Q5 DNA polymerase (NEB, Ipswich, MA, USA). The resulting linear PCR products were digested with DpnI for 1 h at 37°C and subsequently circularized with T4 ligase (Thermo Fisher Scientific, Waltham, MA, USA) for 2 h at 16°C in a blunt-end ligation. Ligation, transformation, and plasmid preps followed common protocols.
Primer sequences used in this project are shown inTable S1 .
To obtain the K855A and e1.0 (K810A/K1003A/R1060A) Cas9 variants, suitable primers were designed to introduce the desired mutations by PCR with Q5 DNA polymerase (NEB, Ipswich, MA, USA). The resulting linear PCR products were digested with DpnI for 1 h at 37°C and subsequently circularized with T4 ligase (Thermo Fisher Scientific, Waltham, MA, USA) for 2 h at 16°C in a blunt-end ligation. Ligation, transformation, and plasmid preps followed common protocols.
Primer sequences used in this project are shown in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!