Total RNA was prepared with the Trizol reagent (Invitrogen) according to the manufacturer's instructions. For miRNA reverse transcription, cDNA was synthesized using TaqManH MicroRNA Reverse Transcription Kit (ABI) with 100 ng total RNA. For mRNA reverse transcription, cDNA was synthesized using ReverTra AceH qPCR RT Kit (TOYOBO) with 1 mg total RNA. Real-time PCRs were performed using SYBRH Select Master Mix for CFX (Invitrogen). Relative quantification was achieved by normalization to the amount of GAPDH (for mRNAs) or snRNA U6 (for miRNAs). The 2−ΔΔCt (ΔCt = CtmiR-543-CtU6) method for quantitation of gene expression was used to determine miR-543 relative expression levels. The ΔΔCt was calculated by subtracting the ΔCt of the reference sample (a normal clinical or mouse tissue sample was chosen for the normalization of clinical samples or samples in two mouse models, LoVo cell was chosen for the normalization of five CRC cell lines) from the ΔCt of each sample. The mean relative miR-543 expression (5.8) of all clinical tumor samples was chosen as the cut-off to classify a tumor sample was High or Low according to their miR-543 expression level. The primers used are shown in Supplementary Table S2 .
Revertra aceh qpcr rt kit
Manufactured by Toyobo
Sourced in Japan
The ReverTra AceH qPCR RT Kit is a laboratory equipment product from Toyobo. It is a real-time reverse transcription PCR (RT-qPCR) kit designed for the detection and quantification of RNA targets.
Automatically generated - may contain errors
3 protocols using revertra aceh qpcr rt kit
1
Quantitative Analysis of miR-543 Expression
2
COUP-TFII Expression Analysis via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissue samples and cell lines using the TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.,) according to the manufacturer's instructions. For mRNA reverse transcription, cDNA was synthesized using the ReverTra AceH qPCR RT kit (Toyobo, Osaka, Japan) with 1 mg total RNA. RT-qPCR was performed via SYBR Green assay (Invitrogen; Thermo Fisher Scientific, Inc.) using the SYBRH Select Master Mix for CFX (Invitrogen; Thermo Fisher Scientific, Inc.) as described (21 (link)). GAPDH was used as the control. The reverse transcription primers and qPCR primers of COUP-TFII and GAPDH were purchased from Thermo Fisher Scientific, Inc. COUP-TFII relative expression was evaluated by using the 2−ΔΔCq method (22 (link)). All PCR assays were performed in triplicate.
3
Quantitative RT-PCR for Sox2 and GAPDH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) after tissue samples and cell lines were harvested. cDNA was synthesized using ReverTra AceH qPCR RT Kit (TOYOBO) with 1 mg total RNA. The primer upstream sequence of Sox2 was 5ʹ-ATGGGTTCGGTGGTCAAGTC −3ʹ and the primer downstream sequence was 5ʹ-CCCTCCCATTTCCCTCGTTT −3ʹ. The primer upstream sequence of GAPDH was 5ʹ- GTGGACCTGACCTGCCGTCT −3ʹ and the primer downstream sequence was 5ʹ- GGAGGAGTGGGTGTCGCTGT −3ʹ. Quantitative RT-PCR was performed for 30 cycles of denaturation (at 94°C for 30 seconds), annealing (at 56°C for 30 seconds) and elongation (at 72°C for 1 minute).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!