Dimethyl sulfoxide (dmso)

The cells’ relative viability was assessed using 3-(4,5-dimethyl thiazolyl-2)-2,5-diphenyl tetrazolium bromide (MTT) obtained from Sigma-Aldrich. At 1, 3, and 7-day intervals, the culture medium was extracted. Both the cell-cultured samples and the control group (with 3 samples in each group) were treated with MTT solution, which consisted of 0.5 g/mL MTT reagent in PBS. After a 4-h incubation period at 37 °C, the dark blue formazan crystals were dissolved in MTT solvent by dimethyl sulfoxide (DMSO) (Bioidea, Iran) and allowed to sit at 37 °C for 30 min. Following this, 100 μL of the dissolved formazan solution from each sample was transferred to a 24-well plate. A microplate reader (Bio Rad, Model 680 Instruments) was used to measure the optical density (OD) of each well at 490 nm wavelength. The relative cell viability was determined using Equation (3) [26 (link)]: $$\mathrm{R}\mathrm{e}\mathrm{l}\mathrm{a}\mathrm{t}\mathrm{i}\mathrm{v}\mathrm{e} \mathrm{c}\mathrm{e}\mathrm{l}\mathrm{l} \mathrm{v}\mathrm{i}\mathrm{a}\mathrm{b}\mathrm{i}\mathrm{l}\mathrm{i}\mathrm{t}\mathrm{y}\left(\mathrm{\%}\right)=\frac{{\mathrm{A}}_{\mathrm{s}\mathrm{a}\mathrm{m}\mathrm{p}\mathrm{l}\mathrm{e}}-{\mathrm{A}}_{\mathrm{b}}}{{\mathrm{A}}_{\mathrm{c}}-{\mathrm{A}}_{\mathrm{b}}}$$
A_Sample, A_b, and A_c represent the absorbance values of the sample, blank (DMSO), and control (TCP), respectively.

BIO-RP-purified DNA oligonucleotides (such as biotin-5′ GGTGGTGGGGGGGGTTGGTAGGGTGTCTTC3′, as a biotin-labelled G-quadruplex insulin aptamer [27 (link)], and DNT staples) were synthesized by Bioneer, Korea. In addition, to rule out non-specific insulin binding, a control 30 mer DNA oligonucleotide was synthesized by Bioneer with a random sequence (biotin-5' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN3′). M13mp18phage genome and T4 DNA ligase were purchased from New England Biolabs (Massachusetts, USA). Quantum Prep Freeze ‘N Squeeze DNA gel-extraction spin columns were obtained from Bio-Rad. Streptavidin (fluidMAG-Streptavidin) magnetic nanoparticles of 100 nm diameter size and a Magneto PURE-Micro separator were purchased from Chemicell (Germany). 3, 3′, 5, 5′ tetramethylbenzidine (TMB), hemin (Bioextra, from porcine), insulin and stop reagent for the TMB substrate were provided from Sigma, USA. Hemin stock solution (5 mM) was prepared in dimethyl sulfoxide (DMSO) (purchased from Bio Idea Company, Tehran, Iran), stored in the dark at – 20°C and diluted to the required concentration with buffer solution (20 mM Tris-HCl, 40 mM KCl, 200 mM NaCl, 0.06%(v/v) Triton X-100, pH 7.4). The desired concentration of insulin was dissolved in binding buffer (20 mM Tris-HCl, 140 mM NaCl, 5 mM KCl, 1 mM CaCl₂ and 1 mM MgCl₂, pH 7.4). The insulin ELISA kit was purchased from Demeditec, Germany.