Hybrid rtm mirna isolation kit

Extraction of microRNAs was carried out using a peripheral blood plasma sample with the Hybrid-RTM miRNA isolation kit (GeneAll Biotechnology, Korea). The purity and concentration of these microRNAs were measured using an ultraviolet spectrophotometer at 260 nm and 280 nm absorption using a Nanodrop spectrophotometer Thermo Fisher Qubit 3.0 (Thermo Fisher Scientific Inc.,Waltham, MA, USA). The microRNA was then stored at –80 °C up to the cDNA synthesis stage. NCBI (National Center for Biotechnology Information) nucleotide database was used for primer sequences of miRNAs.
The sequence used for miR-29c-3p includes primers as follows: Forward: 5’- TAGCACCATTTGAAATCGGTTA-3´(Accession No: MIMAT0000681). For miR-31-5p: Forward: 5’-AGGCAAGATGCTGGCATAGCT-3’(Accession No: MIMAT0000089). For miR-18a-5p: 5’-TAAGGTGCATCTAGTGCAGATAG-3’(Accession No: MIMAT0000072), while U6 snRNA as housekeeping gene includes primers as follows: Forward: 5’- GCTTCGGCAGCACATATACTAAAAT -3´.

Peripheral blood samples taken into EDTA tubes were centrifuged for 10 min at 2500 rpm within 2 h. The plasma was separated into Eppendorf tubes and stored at –80 °C until use. miRs from the plasma samples were isolated using a Hybrid-RTM miRNA isolation kit (GeneAll Biotechnology, Korea) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized from the isolated miRs using the HyperScriptTM reverse transcriptase kit (GeneAll Biotechnology, Korea). Reverse transcription was carried out using a SimpliAmp thermal cycler (Thermo Fisher Scientific Inc.,Waltham, MA, USA). Quantitative real-time polymerase chain reaction (PCR) reactions (qRT-PCR) were performed using a high-capacity StepOnePlus real-time PCR System (Thermo Fisher Scientific Inc.) according to the manufacturer’s instructions. All experiments were performed in triplicate. The expression levels of miRs were calculated using the 2-∆∆Ct method.