Pcmv xl5 vector

The human GPR101 WT (NM_054021.1) coding sequence cloned into the pCMV-XL5 vector was purchased from Origene (SC120214, Origene, Rockville, MD, USA). The p.G31S variant was introduced into the human GPR101 WT template using the QuikChange Lightning site-directed mutagenesis kit (210518-5, Agilent Technologies, Santa Clara, CA, USA), following the manufacturer’s protocol. The following mutagenic primers were used: GPR101-G31S_F: GAGCGGATGATGCTGTGGGCCAGGCTG; GPR101-G31S_R: CAGCCTGGCCCACAGCATCATCCGCTC.

A human prelamin A cDNA in pCMV-XL5 vector (#SC101048) was purchased from Origene (Rockville, MD). A human progerin cDNA was created by deleting 150 nucleotides (1818–1968) from the prelamin A cDNA with the QuikChange Lightening kit (Agilent; Santa Clara, CA) and mutagenic primers (forward primer, 5′-GCTCAGGAGCCCAGAGCCCCCAGAACTG-3′; reverse primer, 5′-CAGTTCTGGGGGCTCTGGGCTCCTGAGC-3′). The doxycycline-inducible vector pTRIPZ-hDDX5/17 (Addgene; Cambridge, MA) was digested with restriction enzymes AgeI and EcoRI to delete the red fluorescence protein and shRNA sequences and then gel-purified. The human prelamin A and progerin cDNAs were amplified with the Titanium Taq PCR kit (Clontech; Mountain View, CA) and sequence-specific primers (forward primer, 5′-GTCAGATCGCACCGGATGGAGACCCCGTCCCAG-3′; and reverse primer, 5′-GTAGCCCCTTGAATTTTACATGATGCTGCAGTTCTGGGG-3′). The fragments were purified with UltraClean15 (Mo-bio) and subcloned into the prepared pTRIPZ vector with In-Fusion Cloning (Clontech). The products were amplified in XL10-Gold Ultracompetent cells (Agilent) and plasmids with the correct sequence were isolated with plasmid kits (Qiagen; Germantown, MD). Packaging of lentivirus and transduction of cells were performed by UCLA’s Vector Core. Transduced cells were selected for two weeks with 1.5 μg/ml puromycin.