Sybr green rt pcr kit

mRNA expression levels of IGF-1 and peroxisome proliferator-activated receptor γ (PPARγ) were determined by qRT-PCR. Total RNA was extracted from cells using TRIzol reagent following the protocol provided by the manufacturer (Invitrogen). cDNA was synthesized from total RNA using a Superscript III first-strand synthesis kit (Invitrogen). qRT-PCR was performed using a SYBR Green RT-PCR kit (Qiagen, Hilden, Germany) and an ABI Prism 7900 Sequence Detection System (PE Applied Biosystems, Foster City, CA, USA). Expression levels were calculated relative to expression of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primer sequences used in this research are listed in Table 1.

Total RNA was isolated using a NucleoSpin RNA Plus XS (Macherey–Nagel) kit and reverse transcription was conducted using the Moloney MLV Reverse Transcription system (Promega). qRT-PCR was performed using a Light Cycler 1.5 System (Roche) or a CFX Connect Real-Time PCR Detection System (Bio-Rad) and a SYBR Green RT-PCR kit according to the manufacturer's instructions (Qiagen) for all the genes except Cyp11b1 and Cyp11b2, which were measured using the Light Cycler Taq Man Master system (Roche Life Science). Primers used are shown in Table S2. qRT-PCR analyses were conducted in triplicate, and Ct values were normalized against the internal control gene beta-actin. Fold differences in expression levels were calculated according to the comparative Ct method [46 (link)].

Quantitative RT-PCR (qRT-PCR) assays were conducted as described (3 (link), 7 (link), 31 (link)). In brief, assays were performed in a 96-well microplate format using a QuantStudio™ 3 Real-Time PCR System (Thermofisher) with validated primers (Supplemental Excel Sheet). Reactions were performed with a SYBR Green RT-PCR kit (Qiagen, Valencia, CA) with 500 ng of total RNA in a 20-μl reaction mixture. Specific optic detection was set at 78°C for 15 s after each amplification cycle of 95°C for 15 s, 56–59°C for 30 s and 72°C for 40 s. Cycle threshold (Ct) values and melting curves were monitored and collected with the included software. Relative gene expression was first normalized against Ct values of the housekeeping gene (GAPDH), and compared with the expression levels of control samples (3 (link), 7 (link), 31 (link)).

Total RNA in cultured cells was isolated using Trizol reagent (Invitrogen, Cat. # 15596–026) following the manufacturer’s instructions, and stored at −80 °C. RevertAid^TM First Strand cDNA Synthesis Kit (Fermentas, Cat. # K1622) was used for reverse transcription. qRT-PCR was performed in the ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA) using the SYBR Green RT-PCR kit (Qiagen, Cat. # 204147). All values were normalized using an internal reference (U6, for miRNAs; and GAPDH, for mRNAs). Relative expression was estimated by the comparative Ct method (2^-ΔΔCt) [18 (link)]. A 2^-ΔΔCt >3 or < 0.3 was deemed to indicate statistical significance.

Total RNA was extracted from T. hemsleyanum leaves according to the instructions of the TransZol Plant kit. The A₂₆₀ and A₂₈₀ values of the extracted RNA samples were measured by using a NanoDrop Micro UV spectrophotometer, and the sample concentrations were calculated. The extracted total RNA was stored in a refrigerator at −80°C. The relevant gene amplification primers were designed by Beacon Designer 7 and synthesized by Shanghai Generay Biotech Co (Table 1). The RNA obtained from three biological replicates of each sample was reverse-transcribed into complementary deoxyribonucleic acid (cDNA) using the TransScript II Probe One-Step kit, and the reverse transcription product was used as the template with MDH (malic dehydrogenase) gene as the internal reference gene. The SYBR Green RT-PCR kit from QIAGEN was used for fluorescence quantification using the FTC-3000 qPCR system (Canada Funglyn Biotech Co., Ltd.). The PCR reaction procedure was as follows: incubation at 95°C for 2 min, followed by 35 cycles at 95°C for 5 s and 60°C for 30 s. Three technical replicates were performed for each sample. The collected data were used to calculate the relative expression of genes using the 2^–ΔΔCt method. Each gene was tested in three biological replicates, with three technical repeats. The data were exhibited as the mean ± SD of three independent experiments.

qRT-PCR was performed to validate the microarray results according to the manufacturer’s protocol with a SYBR Green RT-PCR Kit (QuantiFast SYBR Green PCR Master Mix, Qiagen) on a Bio-Rad CFX96 system. The primers used for the qRT-PCR are shown in Additional file 1: Table S1. The lncRNA expression levels were quantified based on the threshold cycle (Ct) values. β-Actin served as the internal control. The relative gene expression was analyzed using the comparative Ct [2(-ΔΔCt)] method [24 (link)]. Three biological replicates were performed for each group.

Isolation of RNA from mICcl2 cells, BMDCs and colonic tissue lysates was performed using Qiagen’s RNeasy Mini Kit according to manufacturer’s instructions. Additional DNA digestion was conducted by using the DNA-free DNA Removal Kit (Thermo Fisher Scientific). SybrGreen based quantitative RT-PCR was performed on a Roche LightCycler480 using Qiagen SybrGreen RT-PCR Kit. Primer annealing occurred at 60°C. 10–100 ng DNase-digested RNA was used for qRT-PCR. Relative mRNA expression in cells stimulated with bacteria to unstimulated cells was determined by using β-actin as housekeeping gene according to the ΔΔCp-method, which takes into account the specific amplification efficiency of every primer pair and each PCR run. Primer sequences: Nfkbiz (NCBI Gene ID: 80859) forward: GTGGGAGAACAGATCCGACG, reverse: AGTGAGTGTCGCTGAACCAG; β-actin (NCBI Gene ID: 11461) forward: CCCTGTGCTGCTCACCGA, reverse: ACAGTGTGGGTGACCCCGTC.