Log In Sign up
The largest database of trusted experimental protocols

Quikchange lightning multi site directed mutagenesis kit

Manufactured by Agilent Technologies
Visit Supplier
Sourced in United States, United Kingdom, Canada

The QuikChange Lightning Multi Site-Directed Mutagenesis Kit is a laboratory equipment product designed for rapid and efficient site-directed mutagenesis of plasmid DNA. It enables the introduction of multiple mutations in a single reaction.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (9 mentions) Quikchange lightning site directed mutagenesis kit, by Agilent Technologies (5 mentions) Pcdna5 frt to vector, by Thermo Fisher Scientific (4 mentions) Quikchange primer design program, by Agilent Technologies (4 mentions) Pcdna3, by Thermo Fisher Scientific (4 mentions) Dual luciferase assay system, by Promega (3 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (3 mentions) Dual luciferase reporter assay system, by Promega (3 mentions) Bovine serum albumin (bsa), by Merck Group (2 mentions) Pirespuro3 vector, by Takara Bio (2 mentions) Expressed sequence tags, by GE Healthcare (2 mentions) Flag atm wt 31985, by Addgene (2 mentions) Ha ub k0, by Addgene (2 mentions) Quikchange primer design software, by Agilent Technologies (2 mentions) Expi293 cell, by Thermo Fisher Scientific (2 mentions) Inhek293 6e cells, by Thermo Fisher Scientific (2 mentions) Pcmv 3tag 1a, by Agilent Technologies (2 mentions) Fugene 6, by Promega (2 mentions) Pmir report vector, by Thermo Fisher Scientific (2 mentions) Dual glo luciferase reporter assay kit, by Promega (2 mentions)

Close spelling variants of this product

QuikChange Lightning Site-Directed Mutagenesis Kit (750 citations) QuikChange (236 citations) QuikChange mutagenesis kit (187 citations) QuikChange Lightning kit (145 citations) QuikChange kit (139 citations) QuikChange site-directed mutagenesis (131 citations) QuikChange Multi Site-Directed Mutagenesis Kit (129 citations) QuikChange mutagenesis (94 citations) QuikChange Lightning (73 citations) Site-directed mutagenesis (55 citations)

182 protocols using quikchange lightning multi site directed mutagenesis kit

1

Cloning and Mutagenesis of LRRC8 Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human LRRC8A, LRRC8C, LRRC8D, and LRRC8E cDNAs cloned into pCMV6 were purchased from OriGene Technologies (catalog numbers RC226180, RC222603, RC203641, and RC209849, respectively). All cDNAs were tagged on their carboxy terminus with Myc-DDK epitopes. Mutant cDNA constructs were generated by using either the QuikChange Lightning Multi Site-Directed mutagenesis kits (Agilent Technologies) or the Phusion High-Fidelity PCR kit (New England BioLabs) and the restriction-free cloning method (Bond and Naus, 2012 (link)). Mutant and wild-type constructs were confirmed by DNA sequencing.
Yamada T, & Strange K. (2018). Intracellular and extracellular loops of LRRC8 are essential for volume-regulated anion channel function. The Journal of General Physiology, 150(7), 1003-1015.
+ Open protocol
+ Expand
2

GRβ 3'UTR-Luc Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The expression vector pMirTarget containing the 3′UTR of hGRβ (hGRβ 3′UTR-luc) was purchased from (Origene). The binding sites were mutated using the Quik Change Lightning Multi Site-Directed Mutagenesis Kits (Agilent Technologies). Successful mutations were confirmed through sequencing by Operon MWG. Cells were seeded onto a 12-well plate and grown overnight. Transient transfection was performed as described above. To determine the effect of Sweet-P on the T24 bladder cancer cells, we treated 24 h after transfection for 48 hours post transfection, 3′UTR GRβ-Luc WT or mutant expression was measured by luciferase, and pRL-CMV Renilla reporter for normalization to transfection efficiency, using the Promega dual luciferase assay system (Promega, Madison, WI).
McBeth L., Nwaneri A.C., Grabnar M., Demeter J., Nestor-Kalinoski A, & Hinds TD J.r. (2016). Glucocorticoid receptor beta increases migration of human bladder cancer cells. Oncotarget, 7(19), 27313-27324.
+ Open protocol
+ Expand
3

Site-Directed Mutagenesis of HA-CUE2

Check if the same lab product or an alternative is used in the 5 most similar protocols
Using the standard protocol for the QuikChange Lightning Multi Site-Directed Mutagenesis Kit from Agilent Technologies, the indicated mutations in the HA-CUE2 construct (pKD120) were made to make pKD127, pKD129, pKD131, pKD133, and pKD145 (Supplementary file 1).
D'Orazio K.N., Wu C.C., Sinha N., Loll-Krippleber R., Brown G.W, & Green R. (2019). The endonuclease Cue2 cleaves mRNAs at stalled ribosomes during No Go Decay. eLife, 8, e49117.
+ Open protocol
+ Expand
4

Recombinant MntC Protein Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
pLP1215, a vector for expression of recombinant MntC in which the entire N-terminal lipoprotein signal sequence (including the lipobox Cys residue) has been deleted, has been described previously (17 (link)). H50K H123K substitutions (where the residue numbering corresponds to the protein lacking the N-terminal lipoprotein signal sequence, identified as residues 1 to 18) designed to abrogate manganese binding were introduced into pLP1215 with a QuikChange Lightning multisite-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA). Mutagenic primers oLH551 (H50K) and oLH552 (H123K) were designed with the Agilent QuikChange Primer Design Tool, and the mutagenesis reaction was performed according to the kit manufacturer’s recommendations. Following sequence confirmation, the resulting clone for expression of MntC H50K H123K was renamed pLH89. Recombinant MntC proteins were expressed in E. coli and purified as described previously (17 (link)); however, the hydrophobic interaction chromatography step was omitted in the current work.
Handke L.D., Gribenko A.V., Timofeyeva Y., Scully I.L, & Anderson A.S. (2018). MntC-Dependent Manganese Transport Is Essential for Staphylococcus aureus Oxidative Stress Resistance and Virulence. mSphere, 3(4), e00336-18.
+ Open protocol
+ Expand
5

Genetic Manipulation of S. aureus COL

Check if the same lab product or an alternative is used in the 5 most similar protocols
The S. aureus subsp. aureus COL (GenBank: CP000046.1) genomic DNA was a generous gift from Dr. Deepti Jain’s laboratory at RCB. The DNA altering enzymes, including restriction enzymes, T4 DNA Ligase and Phusion Polymerase were bought from NEW ENGLAND BioLabs.
The QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies) was used to generate the mutants. The deoxyribonucleotide triphosphates (dNTPs), oxidized deoxyribonucleotides triphosphates and ribonucleotide triphosphates (rNTPs) were purchased from GE Healthcare. Trypsin enzyme used for limited proteolysis was purchased from Sigma-Aldrich. The DNA oligomers were purchased from Eurofins Scientific. The custom-designed fluorescent-labelled, phosphorylated and other modifications containing oligonucleotides were purchased from Keck Centre at Yale University. All other chemical reagents used were of the high grade and were purchased from commercially available sources.
Nagpal S, & Nair D.T. (2021). The PHP domain of PolX from Staphylococcus aureus aids high fidelity DNA synthesis through the removal of misincorporated deoxyribo-, ribo- and oxidized nucleotides. Scientific Reports, 11, 4178.
+ Open protocol
+ Expand
6

CTNNB1 3' UTR Variant Cloning and Verification

Check if the same lab product or an alternative is used in the 5 most similar protocols
The CTNNB1 3′ UTR variants were cloned into psiCHECK-2, and the HA tag, CTNNB1 CDS and 3′ UTR variants were cloned into pcDNA3.1+ using the primers and restriction sites listed in Supplementary Table 9. Restriction sites or linkers between the CDS and 3′ UTRs were removed using the Quikchange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) as per the manufacturer’s protocol. All constructs were verified by Sanger sequencing.
Chan J.J., Zhang B., Chew X.H., Salhi A., Kwok Z.H., Lim C.Y., Desi N., Subramaniam N., Siemens A., Kinanti T., Ong S., Sanchez-Mejias A., Ly P.T., An O., Sundar R., Fan X., Wang S., Siew B.E., Lee K.C., Chong C.S., Lieske B., Cheong W.K., Goh Y., Fam W.N., Ooi M.G., Koh B.T., Iyer S.G., Ling W.H., Chen J., Yoong B.K., Chanwat R., Bonney G.K., Goh B.K., Zhai W., Fullwood M.J., Wang W., Tan K.K., Chng W.J., Dan Y.Y., Pitt J.J., Roca X., Guccione E., Vardy L.A., Chen L., Gao X., Chow P.K., Yang H, & Tay Y. (2022). Pan-cancer pervasive upregulation of 3′ UTR splicing drives tumourigenesis. Nature Cell Biology, 24(6), 928-939.
+ Open protocol
+ Expand
7

Site-Directed Mutagenesis of pET8a-SUMO-His10

Check if the same lab product or an alternative is used in the 5 most similar protocols
Substitutions were introduced into a pET8a-SUMO-His10 vector using the QuikChange Lightning Multi site-directed mutagenesis kit (Agilent) and the mutagenic oligonucleotides listed in Table S2. Mutations were confirmed by DNA sequencing.
Gopalkrishnan S., Ross W., Akbari M.S., Li X., Haycocks J.R., Grainger D.C., Court D.L, & Gourse R.L. (2022). Homologs of the Escherichia coli F Element Protein TraR, Including Phage Lambda Orf73, Directly Reprogram Host Transcription. mBio, 13(3), e00952-22.
+ Open protocol
+ Expand
8

Cloning and Characterizing miRNA Reporters

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Cloning of luciferase reporters for miRNA binding sites was done as previously described16 (link). Briefly, to express different pre-miRNAs, a mammalian expression vector pBudCE4.1 was used (Thermo Fisher). PCR primers were designed to amply the genomic regions flanking pre-miRNAs (~200-nt upstream and downstream). Mouse mir124-1 was cloned downstream of the CMV promoter between Hind III and BamH I to serve as a control for transfection and expression experiments. Pre-miR-217-WT was cloned downstream of the EF-1α promoter between Not I and Kpn I. All other variants of pre-miR-217 were made using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent). All oligo sequences for cloning can be found in Supplementary Data 6. The dual-luciferase reporter assay was performed according to our published protocol16 (link), with the exception that luciferase activities were measured 48 h after cotransfection of 100 ng pre-miRNA plasmids and 100 ng corresponding reporter plasmids.
Luo Q.J., Zhang J., Li P., Wang Q., Zhang Y., Roy-Chaudhuri B., Xu J., Kay M.A, & Zhang Q.C. (2021). RNA structure probing reveals the structural basis of Dicer binding and cleavage. Nature Communications, 12, 3397.
+ Open protocol
+ Expand
9

Fibronectin and Y-27632 in Vinculin Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bovine fibronectin was purchased from Sigma and used at 10 μg ml−1 diluted in PBS (Sigma). Y-27632 dihydrochloride (Tocris Bioscience) was dissolved in water and used at 50 μM for 30 min. Mouse anti-vinculin antibody (clone hVin1) (Sigma, UK) was diluted (1:500) in 1% Bovine Serum Albumin (BSA) (cat: V9131, Sigma, UK). Dylight 594-conjugated AffiniPure Donkey Anti-Mouse IgG (cat: 715-585-150, Jackson ImmunoResearch, USA) was used as a secondary antibody, diluted in 1% BSA (1:500). Site-directed mutagenesis was performed using the QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent, USA). For western blotting, the primary antibodies used were mouse anti-talin (8d4) (cat: T3287, Sigma) and mouse anti-GFP (cat: 11 814 460 001, Roche), diluted 1:500 and 1:250, respectively, in 2% milk (PBS 0.1% Tween). The secondary antibody was goat anti-mouse IgG conjugated to horseradish peroxidase (cat: A9917, Sigma), diluted 1:5,000 in 2% milk (PBS 0.1% Tween). Bands were detected using enhanced luminol-based chemiluminescent substrate (Promega).
Atherton P., Stutchbury B., Wang D.Y., Jethwa D., Tsang R., Meiler-Rodriguez E., Wang P., Bate N., Zent R., Barsukov I.L., Goult B.T., Critchley D.R, & Ballestrem C. (2015). Vinculin controls talin engagement with the actomyosin machinery. Nature Communications, 6, 10038.
+ Open protocol
+ Expand
10

Site-Directed Mutagenesis of Bone Promoters

Check if the same lab product or an alternative is used in the 5 most similar protocols
Site-directed mutagenesis was carried out on Bsp and osteocalcin luciferase promoter constructs. Putative NF-κB binding sites on the promoters were identified using PROMO v. 8.3 software (Technical University of Catalonia, Barcelona, Spain). Mutants were generated using the QuikChange Lightning multisite-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA). The following primers were used to create site-directed mutagenesis on the Bsp promoter region for each of the three NF-κB binding sites: site 1 (gatatcccagtgtcgggttatttgagggcagggagg), site 2 (gtggatgggtaggtgggttaacaccctcatagaagc), and site 3 (caaagttagtttcctttgcaaacttaggaaatgttc). Similarly, primers used to create site-directed mutagenesis on the osteocalcin promoter region for each of the three NF-κB binding sites are site 1 (attgagactaagactggggtcacagctgcagaattgctca), site 2 (cccacaatgggctaggtccttccccaccaaccac), and site 3 (ttgacataaaactaaccagttcactcccccccaacacaca). MC3T3 cells and primary osteoblasts were cotransfected with corresponding constructs as described above and luciferase activity was measured.
Tarapore R.S., Lim J., Tian C., Pacios S., Xiao W., Reid D., Guan H., Mattos M., Yu B., Wang C.Y, & Graves D.T. (2015). NF-κB Has a Direct Role in Inhibiting Bmp- and Wnt-Induced Matrix Protein Expression. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(1), 52-64.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!