The largest database of trusted experimental protocols

Erα antibody

Manufactured by Abcam
Sourced in United Kingdom

The ERα antibody is a tool used in laboratory research to detect and study the estrogen receptor alpha (ERα) protein. ERα is a nuclear receptor that plays a crucial role in the regulation of gene expression in response to the hormone estrogen. This antibody can be used in various experimental techniques, such as Western blotting, immunohistochemistry, and immunoprecipitation, to identify and quantify the presence and distribution of ERα in biological samples.

Automatically generated - may contain errors

4 protocols using erα antibody

1

Immunohistochemical Analysis of ERα in Mouse Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
E12.5, E13.5 and E14.5 mouse embryos were proceeded for paraffin-embedded classical histology and were sectioned into 5-µm thickness. The sections were mounted on positively charged slides. The slides were deparaffinized using Histolemon and re-hydrated. Epitopes retrieval was performed by incubation in 0.05% citraconic anhydride buffer (pH 7.4) at 100  °C for 15 min. Endogenous peroxidase was inhibited by incubation in 30% H2O2 for 20 min. Endogenous biotin molecules were blocked with endogenous avidin/biotin blocking kit (ab64212), and non-specific binding was blocked by incubation with 10% goat serum diluted in PBS for 1 h. Subsequently, the sections were incubated overnight in a humid chamber at RT 1 h with ERα antibody (1/200; ab32063 abcam). Sections were extensively washed and incubated for 1 h with the biotinylated anti-rabbit IgG secondary antibody (1/500; ab97049 abcam). Sections were extensively washed and incubated 1 h with HRP-conjugated streptavidin (1/1000; ab7403 abcam). The sections were finally treated with diaminobenzidine in the dark, washed, then rapidly counterstained with Mayer’s Hemalun and mounted in Eukitt medium.
+ Open protocol
+ Expand
2

Immunofluorescence Imaging of ERα in Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF-7R and T47DR cells were fixed in 4% polyoxymethylene at 4°C for 20 min, washed with PBS and permeabilized in 0.1% Triton X-100 at room temperature for 10 min. Cells were then blocked in 10% goat serum at room temperature for 30 min, and incubated with ERα antibody (1:100, Abcam, #16660) in 10% goat serum at 4°C overnight. Cells were washed, incubated with secondary antibodies at room temperature for 1 h, washed, incubated with DAPI at room temperature for 15 min. Slides were then covered with fluorescently quencher 30 μl, sealed and photographed with an Olympus confocal microscope.
+ Open protocol
+ Expand
3

ERα Binding Site Identification via EMSA

Check if the same lab product or an alternative is used in the 5 most similar protocols
EMSA was performed as detailed formerly [15 (link)] using DNA fragments containing putative ERα binding sites labeled with [32P] dCTP by Klenow. The sequences of the two potential ERE sites, ERα 1 and 2 (ERE sequences underlined), 25kb downstream of the TLR8 gene are: ERα 1:5’-GGGTCCCCTGTGACCTGCACGTACA -3’, ERα 2: 5’- GGGGTGTGACCTGGCAATTTGTTTA -3’. ERα antibody (abcam, Cambridge, MA) and/or recombinant ERαprotein (Thermo Scientific, Rockford, IL) were incubated with DNA fragments prior to electrophoresis. Relative complex formation was determined using Image J software (NIH) and normalized to the untreated or baseline levels, both designated +1.
+ Open protocol
+ Expand
4

Western Blot Analysis of ERα and GAPDH

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell samples were pelleted, washed with PBS and lysed in a lysis buffer (Beyotime, Shanghai, China). Protein was estimated using Bradford reagent and 30 μg of proteins was loaded on SDS-PAGE. Then the proteins were transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA) after SDS-PAGE using a Bio-Rad Semi-Dry electrophoretic cell. The PVDF membrane was incubated using GAPDH antibody (CW0101, CWBIOTECH), ERα antibody (ab32063, Abcam, Cambridge, England) and horseradish peroxidase (HRP)-conjugated IgG antibody. Enhanced chemiluminescence (Thermo Scientific, Rockford, IL, USA) for HRP was used for immunoreactive protein visualization. GAPDH was used as internal control.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!