Nc mimics inhibitor

Silencing of DUXAP8 and overexpression of RCN2 in caSki and HeLa cell samples were severally achieved by transfection with the duplex shRNAs (Genepharma, Shanghai, China) against DUXAP8 and pcDNA3.1/RCN2. The nonspecific shRNAs and empty pcDNA3.1 vector (Invitrogen) served as the negative control (NC). Besides, miR-1297 mimics/inhibitor and NC mimics/inhibitor were also procured from Genepharma. Cell transfection was performed for 48 h with Lipofectamine 2000 (Invitrogen).

Short hairpin RNA (sh-RNA) targeting MAPK1 (sh-MAPK1) or KCNQ1OT1 (sh-KCNQ1OT1) and negative controls (sh-NC), MAPK1 overexpression vector (pcDNA3.1/MAPK1) and the negative control (empty pcDNA3.1 vector), miR-212-3p mimics/inhibitor and the negative control (NC mimics/inhibitor) were obtained from GenePharma (Shanghai, China). Sequences of plasmids used for cell transfection are provided in Table 1. HK-2 cells were seeded in 6-well plates and grown for 24 h until the cell density reached 30–50%. Later, Lipofectamine 2000 (Thermo Fisher Scientific, USA) was used to transfect shRNAs (50 nM), mimics/inhibitors (40 nM) and pcDNA3.1 vectors (10 nM) into HK-2 cells according to the manufacturer’s protocols. After 48 hours, the efficiency of cell transfection was verified by RT-qPCR.Table 1.

Sequences of plasmids used for cell transfection

Name	Sequence (5ʹ→3ʹ)
sh-MAPK1	GGACCTCATGGAAACAGATCTTTCAAGAGAAGATCTGTTTCCATGAGGTCCTTTTTT
sh-NC	AGATGACACTATAGGTCCGACTTCAAGAGAGTCGGACCTATAGTGTCATCTTTTTTT
sh-KCNQ1OT1	GGTGTTACGACTTGTTGTATTCAAGAGATACAACAAGTCGTAACACC TTTTTT
sh-NC	GATGTGATCATTCTGGTGTTTCAAGAGAACACCAGAATGATCACATCTTTTTT
miR-212-3p mimics	UAACAGUCUCCAGUCACGGCC
NC mimics	CGCCACCUAAGUAGUGCACCU
miR-212-3p inhibitor	GGCCGUGACUGGAGACUGUUA
NC inhibitor	AGGUGCACUACUUAGGUGGCG

HeLa or SiHa cells were plated in 6-well plates, and then incubated for one day. After that, the specific short hairpin RNAs (shRNAs) of SFN (sh-SFN-1/2) or LINC01128 (sh-LINC01128–1/2) and their negative controls (sh-NCs), along with mimics and inhibitor of miR-383-5p or miR-107-mimics, NC mimics/inhibitor were purchased from Genepharma (Shanghai, China). The above plasmids were separately transfected into HeLa or SiHa cells via Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) after 48 h.

The specific shRNAs against LINC01419 (sh-LINC01419#1/2) or PDRG1 (sh-PDRG1#1/2) and pcDNA3.1-PDRG1, as well as their negative control (NC) including the nonspecific shRNA (sh-NC) and empty pcDNA3.1 vector, were all procured from RiboBio (Guangzhou, China). The miR-519a-3p mimics/inhibitor and NC mimics/inhibitor were acquired from Genepharma (Shanghai, China). Thereafter, above plasmids were transfected into the U2OS and Saos-2 cells for 48 h by use of Lipofectamine 2000 (Invitrogen, Carlsbad, CA), as appropriate. The sequences were shown in Table 1.

The specific shRNAs targeting LINC00514 (sh-LINC00514#1/2) were obtained from GenePharma Company to silence LINC00514 in TNBC cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) with sh-NC as the negative control. The pcDNA3.1/LINC00514, pcDNA3.1/CCDC71L and empty NC vector, and miR-6504-5p/miR-3139 mimics/inhibitor and NC mimics/inhibitor, were all provided by GenePharma Company. Cells were reaped after 48 h.

Short hairpin RNAs (shRNAs) targeted the back-splice junction sites of circ_PTN (sh-circ#1/2/3) and sh-NC. Besides, miR-542-3p mimics/inhibitor and the corresponding negative controls (NC mimics/inhibitor) were cloned and synthesized by GenePharma (Shanghai, China). Also, pcDNA vectors loaded with circ_PTN or PIK3R3 were applied for overexpression, with the empty vector as negative control. Transfections of indicated plasmids into GBM cells lasted -48 h using lipofectamine 3000 (Thermo Fisher, USA). Expression levels of the genes were determined with RT-qPCR. The experiments were conducted in triplicate.

The shRNAs designed to target NNT-AS1 (sh-NNT-AS1#1/2) or DDIT4 (sh-DDIT4#1/2) and the relevant nonspecific shRNAs (sh-NC), as well as pcDNA3.1-DDIT4 and empty vector (pcDNA3.1-NC), all were procured from Genechem (Shanghai, China). The miR-496 mimics/inhibitor and NC mimics/inhibitor were constructed by GenePharma (Shanghai, China). VCaP and PC3 cells were transfected with indicated plasmids for 48 h in the presence of Lipofectamine 3000 (Invitrogen).