Nucleospin rna isolation kit

Leukocytes from ~ 5 ml of whole blood collected in heparinized tubes were isolated by centrifuging blood collection tubes for 20 minutes at 1,500 RCF. The buffy coat was gently removed using a disposable transfer pipet, and contaminating erythrocytes were eliminated by lysing in ammonium-chloride-potassium lysing buffer. Leukocytes were washed in PBS and pelleted. Total RNA was extracted using Macherey-Nagel NucleoSpin RNA isolation kits following the manufacturer’s recommended guidelines. To generate cDNA, 5 μl of RNA was combined with 15 μl water and added to an RNA to cDNA EcoDry Premix reaction tube containing oligo dT primers (Clontech) following the manufacturer's recommended guidelines.

Real-time quantitative RT-PCR (RT-qPCR) was performed to evaluate RNA expression. Total RNA was extracted using Nucleospin RNA isolation kits (Macherey-Nagel, Germany), according to the manufacturer’s protocol, and reverse-transcribed using Moloney murine leukemia virus reverse transcriptase with random hexamer primers or oligo(dT) primer (Promega, Madison, WI). RT-qPCR analysis was performed using the SensiFast Sybr green mix (Bioline, London, UK) on a LightCycler system (LC480, Roche Applied Science, Penzberg, Germany). LinRegPCR software was used to analyze the data (Untergasser et al., 2021 (link)). Primers used are shown in Supplementary Table 1.

RNA extraction was performed using the NucleoSpin RNA isolation kit (Macherey–Nagel). cDNA was synthesized from 1 μg total RNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Each cDNA sample was pre-diluted 1:20 and 4 μl were used with 4 × Luminaris Color HiGreen qPCR Master Mix (Thermo Fisher Scientific) and 250 nM primer for the qPCR reaction. A two-step cycling protocol was performed as follows: UDG pre-treatment for 2 min (50 °C), initial denaturation for 10 min (95 °C), 40 cycles of 15 s at 95 °C, 40 s at 60 °C (CFX Connect Thermal Cycler, Bio-Rad). The relative quantity of the target mRNA was normalized to beta-2-microglobulin). The fold changes in RNA expression were calculated using the 2^−ΔΔCt method^{28 (link)}. Primer sequences are listed in supplementary information.

For gene expression, cells were cultured on TCP discs in both BM and OM. Samples (n = 3 per condition) were collected at day 4, day 7 and day 14. Bone-related gene expression was evaluated with quantitative real-time polymerase chain reaction (PCR) assay. RNA isolation was performed using Trizol reagent (Invitrogen) and Nucleospin RNA isolation kit (Macherey-Nagel Gmbh & Co.) according to the manufacturer’s instructions. Total RNA was measured using a NanoDrop spectrophotometer (NanoDrop technologies, USA). The RNA was used to synthesize complementary DNA (cDNA) with an iScript cDNA Synthesis kit (BioRad) according to the manufacturer’s instructions. PCR analysis was performed with a Bio-Rad real-time PCR system (Bio-Rad, Hercules, CA, USA) on alkaline phosphate (ALP), collagen type I (Col I), osteocalcin (OCN), and osteopontin (OPN), with beta-2 microglobulin (B2M) as the house-keeping gene used for normalization. Primer sequences for ALP, Col I, OCN, OPN, and B2M are listed in Table 1. The relative amounts of target genes normalized by B2M were calculated by 2^−ΔCT method where ΔC_T = C_T,Target − C_T,B2M.Table 1

qPCR primer sequences.

Gene	Forward primer	Reverse primer
OCN	GGCAGCGAGGTAGTGAAGAG	GATGTGGTCAGCCAACTCGT
OPN	CCAAGTAAGTCCAACGAAAG	GGTGATGTCCTCGTCTGTA
ALP	ACAAGCACTCCCACTTCATC	TTCAGCTCGTACTGCATGTC
COL-I	AGGGCCAAGACGAAGACATC	AGATCACGTCATCGCACAACA
B2M	GACTTGTCTTTCAGCAAGGA	ACAAAGTCACATGGTTCACA

Samples for real-time PCR (RT-PCR) analysis were collected in the late exponential growth phase during the fermentation experiment. The RNA in the samples was stabilized by adding two volumes of RNAprotect reagent (Qiagen Korea Ltd., Korea) and processed as dictated in the protocol. The cell pellets, as treated with RNAprotect, were stored at −80 °C prior to extraction of total RNA. A Nucleospin^® RNA isolation kit (MachereyNagel, Germany) was used to isolate the total RNA from the processed pellets. The RNA was quantified in a UV-spectrophotometer and checked in agarose gel for integrity and concentration. The isolated total RNA and random hexamers were used to synthesize cDNA using the SuperScript III first-strand synthesis system (Thermo Fisher Scientific, Waltham, MA, USA). RT-PCR analysis was performed using the synthesized cDNA, gene-specific primers and Power SyBr^® Green (Thermo Fisher Scientific). RT-PCR was performed in a 48-well StepOne real-time PCR system (Thermo Fisher Scientific), and rpoD was used as an endogenous control. The experiment was performed in duplicate, and relative mRNA quantification was performed according to the ΔC_T method [35 (link)].

Total RNAs were isolated using the NucleoSpin RNA isolation kit (Macherey‐Nagel, 740955‐250), and 1 μg of total RNA was transcribed using SuperScript VILO cDNA synthesis kit (Invitrogen). Quantitative reverse transcription PCR was performed using Light Cycler 480 SYBR Green I Master Mix (Roche) and a Light Cycler 480 II (Roche). Reaction steps: 95°C for 15 min and 40 cycles of 95°C 15 s, 60°C 30 s, and 72°C 10 s. Relative quantities of mRNAs were normalized to 18S. Primers for 18S: GTCTTGTAGTTGCCGTCGTCCTTG (forward) and GTCTTGTAGTTGCCGTCGTCCTTG (reverse), for 3‐Hydroxy‐3‐Methylglutaryl‐CoA Reductase (HMGCR): ATGGAAACTCATGAGCGTGGT (forward) and AGCTCCCATCACCAAGGAGT (reverse), and for LDL receptor: TGGCTGCGTTAATGTGACACTC (forward) and AGCCGATCTTAAGGTCATTGC (reverse).