RNA-guided DNA endonuclease was performed to edit genes through co-expression of the Cas9 protein (Addgene plasmid 41815) with gRNAs (http://www.addgene.org/crispr/church/ ). The targeting sequence (5′-GCGGCGCGCCACCCGCAGCG-3′) for lamin A/C was cloned into the gRNA cloning vector (Addgene plasmid 41824) via the Gibson assembly method (New England Biolabs). Lamin A/C-knockout HeLa cells were obtained through clonal propagation from a single cell. For genotyping, the following PCR primers were used: 5′-CGCACCTACACCAGCCAA-3′ and 5′-CGAACTCACCGCGCTTTC-3′. The PCR products were cloned and sequenced.
Cas9 protein
Manufactured by Addgene
Sourced in United States
Cas9 protein is a essential component of the CRISPR-Cas9 gene editing system. It functions as a programmable DNA endonuclease that can be directed to specific genomic targets by a guide RNA to introduce double-strand breaks in the DNA.
Automatically generated - may contain errors
5 protocols using cas9 protein
1
Genetic Manipulation of Lamin A/C in HeLa Cells
2
CRISPR Medaka gli3 Gene Knockout
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two single guide RNAs (sgRNAs) targeting exon 5 of medaka gli3 were designed using the CRISPRscan (35 (link)) and CCTop (36 (link)) CRISPR design online tools. sgRNAs were generated and purified for injection as previously described (37 ). For sgRNA generation, the following primers were aligned (by PCR) to a universal CRISPR primer: gli3 exon 5 sgRNA1: 5'-taatacgactcactataGGGCGGATGTAGTCCATGTAgttttagagctagaa-3' and gli3 exon 5 sgRNA2: 5'-taatacgactcactataGGGGTGAGATCCGAATGAGGgttttagagctagaa-3' (in both primers the target site is identified by capital letters). Following synthesis, 5 nL of a solution containing both sgRNAs at a concentration of 40 ng/μL and Cas9 protein (Addgene; 47327) at a concentration of 250 ng/μL (38 (link)) were injected into one-cell-stage medaka embryos. Oligos used for screening of genomic DNA deletions flanking CRISPR target sites were the following: forward primer 5'-CGTGAGTTTCACAGCAACAATTA-3' and reverse primer 5'-CAGCCTCACTGATCAATTTCAG-3'. Mutations in gli3 were analyzed by standard PCR and gel electrophoresis as the distance between both sgRNA protospacer adjacent motif (PAM) sequences was 82 bp, long enough to create a deletion easily detected by a shift in the PCR band. Specific deletions in the gli3 gene were further analyzed by Sanger sequencing of the PCR product from F1 embryos (Stab Vida).
3
CRISPR-Cas9 Editing of Lamin A/C
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA‐guided DNA endonuclease was performed to edit genes through co‐expression of the Cas9 protein (Addgene plasmid 41815) with gRNAs (http://www.addgene.org/crispr/church/ ). The targeting sequence for lamin A/C was 5′‐GGAGCTCAATGATCGCTTGG‐3′. The target sequences were cloned into the gRNA cloning vector (Addgene plasmid 41824) via the Gibson assembly method (New England Biolabs). Lamin A/C‐knockout cells were obtained through clonal propagation from a single cell. For genotyping, the following PCR primers were used: 5′‐CGCACCTACACCAGCCAA‐3′ and 5′‐CGAACTCACCGCGCTTTC‐3′. PCR products were cloned and sequenced.
4
CRISPR-Mediated Cidea Knockout in ESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate CIDEA KO ESCs, two sgRNAs were designed by the MIT online tool (http://crispr.mit.edu ), to target the first intron and the last exon, leading to the complete deletion of the Cidea locus. Oligos encoding the sgRNAs were inserted into px458 and px459 plasmids, which also encode the Cas9 protein (Addgene, gifted by Feng Zhang). Plasmids were transfected into ESCs by nucleofection (Lonza, VPH-1001) following the manufacturer’s protocol. Successfully transfected cells were selected by transient antibiotic resistance and fluorescence expression. These cells were then sub-cloned manually and PCR (NEB, M0482; 30 cycles of 94 °C for 30 s, 60 °C for 30 s and 68 °C for 40 s) genotyped using primer pairs flanking the edited loci (see Supplementary Data 1 ). A scheme of gene-editing strategy and genotyping can be found in Supplementary Fig. 2d .
5
CRISPR-Cas9 Mutagenesis with Optimized gRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DR274 gRNA plasmids and Cas 9 protein were from Addgene (Cambridge Massachussets, USA) and New England Biolabs (Ipswich, MA, USA), respectively. CRISPR gRNAs were designed using CRISPR design software (http://crispor.tefor.net/ and http://crispr.dbcls.jp/). Different sgRNAs have been tested and we selected the two with the highest mutagenesis efficiencies. The DNA binding sites targeted by these sgRNAs are localized in the vWA domain (5'-GGATAAGACACGTGTGGCAG -3') and in the TSPN domain (5'-GGATGGCGAGAACAGGGCGG -3'). Oligonucleotides were annealed in a thermo block at 95°C for 5 min followed by a slow cooling to room temperature (≈25°C) and cloned in DR274 gRNA plasmid between BsaI sites. All constructs were verified by sequencing. To make gRNA, the template DNA was linearized by DraI (NEB-R0129) digestion and purified using a was generated by in vitro transcription using a T7 MEGAscript transcription kit (AM1334-Thermo Fisher Scientific, Waltham, Massachussets, USA). After in vitro transcription, the gRNA was purified using ammonium acetate precipitation and stored at -80°C. Cas9 protein (2.12 ng) (New England BioLabs Inc. Ipswich, MA, USA,) and gRNA (133 pg) were co-injected in the cell at the one-cell stage and a quarter of the lay was used to evaluate mutagenesis efficiency by HRMA as previously described in (Talbot and Amacher, 2014) .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!