Qpcr supermix

After being treated with cytokine for 24h, the cells were digested with trypsin and collected in 1.5 mL tubes, then the total cellular RNA was extracted using Fast total RNA extraction kit (FASTAGEN, Shanghai, China) and reverse-transcribed. Quantitative Real-time PCR (qRT-PCR) was performed using the qPCR SuperMix (TransGen) on Roche LightCycler480II (Basel, Switzerland). The relative gene expression levels were calculated by the comparative threshold cycle method (2^–ΔΔCT). The primer sequences are shown in Supplementary Materials (Table S1).

Total RNA was isolated using an RNAprep Pure Plant Kit (Tiangen, Beijing, China). First‐strand cDNA was synthesized using a TransScript II One‐Step gDNA Removal and cDNA Synthesis SuperMix Kit (TransGen, Beijing, China). The primers used for RT‐PCR were designed with Beacon Designer 7 and synthesized by the Sangon Biotech Co. (Shanghai, China) (Table S1). The RT‐PCRs were performed using cDNAs as templates with qPCR SuperMix (TransGen). Three biological and three technical replicates for each reaction were analysed on a CFX96 instrument (Bio‐Rad, Hercules, CA). The thermal cycling conditions were as follows: 94 °C for 30 s followed by 40 cycles of 94 °C for 5 s, 58 °C for 15 s, and 72 °C for 10 s. A melting curve was produced for each sample at the end of each run. Transcript abundance was calculated using the cycle threshold (Ct)
2-ΔΔCt method (Livak and Schmittgen, 2001).

Bm12 cells in the logarithmic phase were inoculated into 12-well plates and cultured for 12 h. Different concentrations of DA (final concentrations 0.02 mg/L, 0.2 mg/L, 2 mg/L) were added to the experimental groups, and control was set up. Total RNA was extracted and tested for its purity and concentration after 8 h, and then RNA was used as the template to synthesize the cDNA for the polymerase chain reaction. The silkworm GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene was the reference gene. The qPCR reaction system consisted of 1 µL cDNA, 1 µL for both forward and reverse primers, 10 µL qPCR SuperMix (TransGen Biotech, Beijing, China), and 7 µL nucleic acid-free water. The qPCR reactive program was subjected to 39 cycles at 95 °C for 10 s, 60 °C for 10 s, 72 °C for 30 s, then 95 °C for 10 s, and 65–95 °C for 5 s. The qPCR data were analyzed by the 2^−ΔΔCt. The means and DMRT (Duncan multiple range tests) were evaluated using SPSS software.

Total RNA was extracted from 40 GV, MI or MII oocytes using a RNeasy micro‐RNA isolation kit (Qiagen) following the manufacturer's instructions. Samples were treated with DNase I, and then Transcript‐Uni Cell was used for cDNA Synthesis. A Q‐PCR super‐mix was used for the assays (Trans Gen Biotech). RNA concentrations were measured using a Nanodrop 2000 Spectrophotometer (Biolab, Scoresby) at a wavelength of 260 nm. Samples for subsequent analyses were only used if their 260:280 nm absorbance ratios were >1.8. Primers for the published reference RNA sequences for real‐time Q‐PCR and RT‐PCR are listed in Table 1.Q‐PCR and RT‐PCR assays were performed with an ABI 7500 real‐time PCR instrument and a Fast 96‐well Thermal Cycler (Applied Biosystems), respectively. Three replicates were conducted for all assays. The relative expression of genes was calculated with the comparative threshold cycle (CT) method as 2^–ΔΔCT. The primers used for the amplification assays are shown in Table 2.

RNA extraction was conducted using TRIzol (Invitrogen). Reverse transcription was conducted using M‐MLV (Promega). qPCR was performed on a Bio‐Rad CFX instrument with qPCR SuperMix (TransGen Biotech). The primer sequences contained E‐cadherin forward, 5′‐CGAGAGCTACACGTTCACGG‐3′, and reverse, 5′‐GGGTGTCGAGGGAAAAATAGG‐3′; N‐cadherin forward, 5′‐TGCGGTACAGTGTAACTGGG‐3′, and reverse, 5’‐GAAACCGGGCTATCTGCTCG‐3’; GAPDH forward, 5′‐TGACTTCAACAGCGACACCCA‐3′, and reverse, 5′‐CACCCTGTTGCTGTAGCCAAA‐3′. GAPDH served as the internal control.

Total RNA was extracted from transfected or infected cells using Total RNA Kit I (Omega Bio-tek, Shenzhen, China) and used for cDNA synthesis by a HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). Then, the cDNA was used for PCR or qPCR by Taq DNA polymerase (TaKaRa Bio Inc., Otsu, Japan) or qPCR SuperMix (TransGen Biotech, Beijing, China). The sequences of the primers used are available upon request. GAPDH was used as a reference housekeeping gene for internal standardization. For quantification, the 2-ΔΔCt methods were used to calculate the relative RNA levels against the GAPDH [34 (link)].