Log In Sign up
The largest database of trusted experimental protocols

T7 ribomax kit

Manufactured by Promega
Visit Supplier
Sourced in United States

The T7 RiboMax kit is a product that allows for the in vitro transcription of RNA from DNA templates. It utilizes the T7 RNA polymerase system to generate high yields of RNA molecules.

Automatically generated - may contain errors

Lab products found in correlation

Glutamine, by Wisent (2 mentions) Express five medium, by Thermo Fisher Scientific (2 mentions) X tremegene hp dna transfection reagent, by Roche (2 mentions) Penicillin, by Wisent (2 mentions) Streptomycin, by Wisent (2 mentions) Rneasy protocol, by Qiagen (2 mentions) Nanodrop, by Thermo Fisher Scientific (2 mentions) Polyfect, by Qiagen (1 mentions) Streptavidin agarose beads, by Merck Group (1 mentions) Rneasy purification columns, by Qiagen (1 mentions) Nanoject 2, by Drummond (1 mentions) System microscope bx63, by Olympus (1 mentions) Anti reverse cap analog, by TriLink (1 mentions) Rneasy mini kit, by CellScript (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Minelute pcr purification kit, by Qiagen (1 mentions)

Close spelling variants of this product

T7 RiboMAX Express RNAi kit (18 citations) RiboMAX Large Scale RNA Production Systems-T7 Kit (10 citations) T7 RiboMAX Express Large kit (2 citations) RiboMAX Large-Scale RNA Production-T7 Kit (9 citations) T7 RiboMAX Express RNAi Systems kit (2 citations) T7 RiboMAX Express kit (12 citations) RiboMAX T7 RNA polymerase kit (3 citations) RiboMax T7 transcription kit (2 citations) T7 Ribomax in vitro transcription kit (4 citations) RiboMAX Large Scale RNA Production System-T7 kit (27 citations)

18 protocols using t7 ribomax kit

1

Synthesis of FCoV 5'NC RNA

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
A single-stranded DNA segment encoding 36 nucleotides of the 5′NC of FCoV genomic RNA, flanked by T7 promoter, was synthesized by IDT. The resulting DNA segment was PCR amplified in a PCR reaction using two opposing primers. The PCR product was gel purified and used as template in an in vitro T7 transcription reaction. RNA synthesis was carried out using the T7 RiboMax kit (Promega), following the manufacturer’s instructions. The RNA was biotinylated or radiolabeled during synthesis as reported (31 (link), 32 (link), 33 (link)).
Mohseni N., Royster A., Ren S., Ma Y., Pintado M., Mir M, & Mir S. (2023). A novel compound targets the feline infectious peritonitis virus nucleocapsid protein and inhibits viral replication in cell culture. The Journal of Biological Chemistry, 299(3), 102976.
+ Open protocol
+ Expand
2

FOXO1 interacts with HTTCAG47 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were transfected with or without FOXO1 using Polyfect (Qiagen). Cells were lysed 48 h post-transfection in Buffer D (20 mM Tris pH7,9, 20% glycerol, 0,1MKCl, 0,2 mM EDTA, 0,5 mM DTT, protease inhibitor, RNase inhibitor) by sonication. Biotinylated HTTCAG47 mRNA was generated by PCR-amplification of HTT-exon1 using primers with a T7 site in the forward primer (CCAAGCTTCTAATACGACTCACTATAGGGAGAATGGCGGACCCTGGAAAAGCTCATGAAGG and GGTCGGTGCAGCGGCTCCTCAGC) and in vitro transcription using the T7 RiboMAX Kit (Promega). Purified transcripts were then coated onto Streptavidin–Agarose beads (SIGMA) and incubated with cell lysates. After washing the beads with Buffer D, RNA-bound proteins were analysed by mass spec at the UMCG. Mass spec analysis was done on three biological repeats.
Furtado G.V., Yang J., Wu D., Papagiannopoulos C.I., Terpstra H.M., Kuiper E.F., Krauss S., Zhu W.G., Kampinga H.H, & Bergink S. (2021). FOXO1 controls protein synthesis and transcript abundance of mutant polyglutamine proteins, preventing protein aggregation. Human Molecular Genetics, 30(11), 996-1005.
+ Open protocol
+ Expand
3

RNAi-Mediated Cortical Flow Disruption

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA interference targeting mlc-4 to eliminate cortical flow was performed by injection. We amplified 1 kb of mlc-4 from cDNA using primers that added T7 promoters to both ends of the amplified fragment. dsRNA was then synthesized using the T7 Ribomax kit (Promega) as instructed by the manufacturer. 1 mg/mL mlc-4 dsRNA was injected into young adults in either GFP:Utrophin background or EOD; PAR-3 background, and the worms were dissected 24–28 h later for embryo imaging.
Chang Y, & Dickinson D.J. (2022). A particle size threshold governs diffusion and segregation of PAR-3 during cell polarization. Cell reports, 39(2), 110652.
+ Open protocol
+ Expand
4

Drosophila Cell Culture and Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
All cells were in the D-Mel (d.mel-2) background and were cultured in Express Five medium (Invitrogen) supplemented with glutamine, penicillin and streptomycin (Wisent). Transfections were performed using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer's instructions. All stable cell lines were selected in medium containing 20 µg ml−1 blasticidin. While inducible pMT-based vectors contain the blasticidin resistance gene, pAc5-based vectors were co-transfected with pCoBlast to confer blasticidin resistance to the cells. Expression of the copper-inducible transgenes was induced with CuSO4 (300 µM unless otherwise indicated) for at least 8 h before experiments.
For RNA interference, dsRNAs were generated from PCR amplicons using a T7 RiboMAX kit (Promega). dsRNA derived from the bacterial kanamycin resistance gene was used as a non-target control. Twenty milligrams of dsRNA was transfected in 1X106 cells in a well of a 6-well plate using Transfast transfection reagent according to the manufacturer's protocol.
Emond-Fraser V., Larouche M., Kubiniok P., Bonneil É., Li J., Bourouh M., Frizzi L., Thibault P, & Archambault V. (2023). Identification of PP2A-B55 targets uncovers regulation of emerin during nuclear envelope reassembly in Drosophila. Open Biology, 13(7), 230104.
+ Open protocol
+ Expand
5

Generating Biotinylated and Radiolabeled RNA

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The DNA sequences encoding the VCP mRNA 5’ UTR and random 5’ UTR were PCR amplified from plasmid P1 and plasmid P4, respectively, using the appropriate forward and reverse primer. The forward primers contained a flanking T7 promoter at the 5’ terminus. As previously reported [46 (link)], overlapping PCR was used to incorporate a point mutation in the VCP mRNA 5’ UTR at 545 nucleotides from the 5’ terminus by converting the AUG codon to AUC. The DNA segments encoding other deletion mutants used in Fig 8 were generated using similar approach. The PCR products were gel purified and used as template in an in vitro T7 transcription reaction. RNA synthesis was carried out using the T7 RiboMax kit (Promega), following the manufacturer’s instructions. The RNA was either biotinylated or radiolabeled with [α32P] GTP during synthesis as previously reported [35 (link),47 (link),48 (link)].
Royster A., Ren S., Ali S., Mir S, & Mir M. (2024). Modulations in the host cell proteome by the hantavirus nucleocapsid protein. PLOS Pathogens, 20(1), e1011925.
+ Open protocol
+ Expand
6

RNAi Screening for PAR-3 Clustering Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
To screen candidate genes for effects on PAR-3 clustering, RNAi was
performed by injection. First, we amplified 0.5–2 kb of coding
sequence from cDNA using primers that added T7 promoters to both ends of the
amplicon. dsRNA was then synthesized using the T7 Ribomax kit (Promega),
following the manufacturer’s instructions. 1 μg/μL
dsRNA was injected into young adults, and embryos were collected
23–32h later for imaging. The following genes were targeted:
air-1, cdc-37, cdc-42, cdk-1, let-502, mel-11, mrck-1, pak-1,
par-1, par-2, par-5, pkc-3, plk-1 and
pri-1.To partially deplete plk-1 (Figure 8H), RNAi was
performed by timed feeding. Clone III-4E08, targeting
plk-1, was retrieved from the Ahringer RNAi library
(Kamath and Ahringer, 2003 (link)) and
verified by Sanger sequencing before use. Log-phase cultures of this
bacterial strain were grown in LB, spotted onto NGM plates supplemented with
25 μg/mL Carbenicillin and 1 mM IPTG, and the plates were incubated
for 3 days at ambient temperature. Young adults were picked onto these
plates, and embryos dissected for imaging at different times thereafter. We
found that embryos collected 9–14h after the start of feeding
retained PAR-3 clusters at the cortex during maintenance phase, but still
divided normally.
Dickinson D.J., Schwager F., Pintard L., Gotta M, & Goldstein B. (2017). A single-cell biochemistry approach reveals PAR complex dynamics during cell polarization. Developmental cell, 42(4), 416-434.e11.
+ Open protocol
+ Expand
7

Drosophila Cell Culture and Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
All cells were in the D-Mel (d.mel-2) background and were cultured in Express Five medium (Invitrogen) supplemented with glutamine, penicillin and streptomycin (Wisent). Transfections were performed using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer's instructions. All stable cell lines were selected in medium containing 20 µg ml−1 blasticidin. While inducible pMT-based vectors contain the blasticidin resistance gene, pAc5-based vectors were co-transfected with pCoBlast to confer blasticidin resistance to the cells. Expression of the copper-inducible transgenes was induced with CuSO4 (300 µM unless otherwise indicated) for at least 8 h before experiments.
For RNA interference, dsRNAs were generated from PCR amplicons using a T7 RiboMAX kit (Promega). dsRNA derived from the bacterial kanamycin resistance gene was used as a non-target control. Twenty milligrams of dsRNA was transfected in 1X106 cells in a well of a 6-well plate using Transfast transfection reagent according to the manufacturer's protocol.
Emond-Fraser V., Larouche M., Kubiniok P., Bonneil É., Li J., Bourouh M., Frizzi L., Thibault P, & Archambault V. (2023). Identification of PP2A-B55 targets uncovers regulation of emerin during nuclear envelope reassembly in Drosophila. Open Biology, 13(7), 230104.
+ Open protocol
+ Expand
8

Replicon Vector-Based Luciferase Assay

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The replicon vector is based on the current investigational new drug (IND) VEE virus vaccine (TC-83)(28 (link)). The red firefly (rFF) luciferase gene was PCR-amplified from a commercial DNA plasmid (ThermoFisher), and cloned as an AscI fragment into the replicon plasmid as previously described(29 (link)). The orientation of the gene was determined by restriction digest analysis and clones in the sense orientation were selected and sequence verified. The replicon construct was 9420 bases in length. Replicon RNA was prepared as described previously(30 (link)). Briefly, capped replicon RNAs were in vitro transcribed using a T7 RiboMax kit (Promega, Madison WI) following the manufacturer’s instructions, supplemented with 7.5 mM CAP analog (Promega, Madison, WI), from NotI linearized replicon plasmid. RNAs were purified using RNEasy purification columns (Qiagen, Valencia, CA) following the manufacturer’s instructions. RNA was aliquoted and stored at −80 °C until utilized.
He W., Evans A.C., Rasley A., Bourguet F., Peters S., Kamrud K.I., Wang N., Hubby B., Felderman M., Gouvis H., Coleman M.A, & Fischer N.O. (2020). Cationic HDL mimetics enhance in vivo delivery of self-replicating mRNA. Nanomedicine : nanotechnology, biology, and medicine, 24, 102154.
+ Open protocol
+ Expand
9

Adiponectin and Lipophorin Gene Silencing in Mosquitoes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The adiponectin receptor gene (AGAP004486) fragment between base pairs 37 and 564 of the coding sequence and the lipophorin gene (AGAP001826) fragment between base pairs 9370 and 9936 of the coding sequence were amplified from cDNA collected from midguts using PCR. Adiponectin receptor (AdpR) and lipophorin dsRNAs were further synthesized from the PCR-amplified fragments using a T7 RiboMAX kit (Promega). The primer sequences are listed in Table S3 in the supplemental material. Gaussia luciferase dsRNA was used as the control for dsRNA injection. Two days before the blood meal, 100 ng of dsRNA was injected into the thoraces of female mosquitoes under ice anesthesia. The injection was performed using a nanoinjector (Nanoject II; Drummond) with a glass capillary needle, as previously described (43 (link)).
Chuang Y.M., Stone H., Abouneameh S., Tang X, & Fikrig E. (2023). Signaling between mammalian adiponectin and a mosquito adiponectin receptor reduces Plasmodium transmission. mBio, 15(1), e02257-23.
+ Open protocol
+ Expand
10

Tracking EV71-GFP Expression in SCARB2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
pWSK-EV71-GFP was linearized XbaI and EV71-GFP RNAs were transcribed using the T7 RiboMax kit (Promega). After transfection into 293A-SCARB2-L3HYPDH and 293A-SCARB2-Ctrl cells, the GFP signal was observed under a fluorescence microscope (System Microscope BX63, Olympus) at the indicated times; total RNAs were isolated for RT-qPCR assay.
Liu J., Liu L., Zeng S., Meng X., Lei N., Yang H., Li R., Mu X, & Guo X. (2024). Inhibition of EV71 replication by an interferon-stimulated gene product L3HYPDH. Virus Research, 342, 199336.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!