M mulv reverse transcriptase enzyme

5×10⁶ Raji cells were harvested and washed two times by RPMI 1640 culture medium. Cells were lysed with 1 ml of RNX-plus solution (CinnaGen, Tehran, Iran) and RNA extraction was done following the manufacturer's instructions. Briefly, 200 µl chloroform was added to cell lysate and incubated for 5 min on ice.
Following centrifugation and collection of the aqueous phase in new tube, the total RNA was precipitated by isopropanol in equal volume after incubation for 15 min. The RNA pellet was washed by 75% ethanol and resolved in RNase-free double distilled water. Prior to cDNA synthesis, RNA concentration was determined by UV spectrophotometry and integrity of extracted RNA was checked by agarose gel electrophoresis. 5 µg of total RNA together with 1 µl random hexamer (N6) primer (Thermo Fisher Scientific, Inc., MA, USA) were heated at 65°C for 5 min and placed on ice. Then, 200 U MMuLV reverse transcriptase enzyme (Thermo Fisher Scientific, Inc., MA, USA), 4 µl of 5× reaction buffer (Thermo Fisher Scientific, Inc., MA, USA) and 1 µl of 10 mM dNTP (Thermo Fisher Scientific, Inc., MA, USA) were added to the reaction and incubated at 25°C for 10 min followed by 60 min at 42°C. To terminate the cDNA synthesis, the reaction was heated at 70°C for 10 min. Finally, β-actin as a housekeeping gene was amplified for confirming synthesis of cDNA.

RNA was extracted using the RNeasy Plus kit (Qiagen) according to the manufacturer's instructions. Equal amounts (1 μg) of RNA from each sample were used for cDNA synthesis using random primers and M‐MuLV reverse transcriptase enzyme (Thermo Scientific). QPCR analysis was carried out on a Stratagene Mx3005P system (Agilent Technologies) using Maxima SYBR Green/Rox, according to the manufacturer's instructions (Thermo Scientific). For sample loading control, GAPDH, hypoxanthine phosphoribosyltransferase 1 (HPRT1) and TATA‐binding protein (TBP) were tested, and TBP was found to be the most evenly expressed among the different melanoma cell lines used. Furthermore, the expression of TBP remained unchanged throughout all the treatments. The primers used were as follows: WNT5A‐Fw (5′‐TCAGGACCACATGCAGTA‐3′), WNT5A‐Rv (5′‐CTCATGGCGTTCACCACC‐3′), TBP‐Fw (5′‐GACTCTCACAACTGCACCCTTGCC‐3′), and TBP‐Rv (5′‐TTTGCAGCTGCGGTACAATCCCAG‐3′).

Total RNA was extracted using the RNeasy Plus Kit according to the manufacturer's instructions (Qiagen, Hilden, MD, USA). Equal amounts of RNA were used for cDNA synthesis using random hexamers and the M-MuLV reverse transcriptase enzyme (Thermo Scientific). qRT–PCR was performed in triplicates using Maxima SYBR Green/Rox (Thermo Scientific) according to the manufacturer's instructions. qRT–PCR analysis was performed on the Mx3005P QPCR system (Agilent Technologies, Santa Clara, CA, USA) and the relative mRNA expression was normalised to YWHAZ, UBC and SDHA and calculated using the comparative Ct method (Vandesompele et al, 2002 (link)). For primer sequences, see Supplementary Table S1.