Total RNA from the liver was isolated with Trizol reagent according to the manufacturer's protocol (Takara Biotechnology, Dalian, China), and cDNA synthesis was carried out with reverse transcriptase containing 100 ng of total RNA, oligo dT primer, and PrimeScript RT Enzyme Mix according to the manufacturer's instructions (RT-for-PCR kit, Takara Biotechnology). Real-time PCR was performed with a CFX System (Bio-Rad) according to the manufacturer's instructions (Takara Biotechnology). GAPDH or ribosomal protein S6 (Rps6) was selected as a housekeeping gene for normalizing all the gene expressions. Primers used for PCR reactions were designed using available gene sequences as shown in Table 1 .
Primescript rt enzyme mix
Manufactured by Takara Bio
Sourced in Japan, China, United States
The PrimeScript RT Enzyme Mix is a reverse transcriptase enzyme used for the synthesis of complementary DNA (cDNA) from RNA templates. It is a versatile and efficient tool for the conversion of RNA into cDNA, which is a critical step in various molecular biology applications, such as gene expression analysis, RNA quantification, and cDNA library construction.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Trizol reagent, by Takara Bio (4 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (4 mentions)
Cfx system, by Bio-Rad (3 mentions)
Sybr premix ex taq 2, by Takara Bio (3 mentions)
Rnaiso for small rna, by Takara Bio (3 mentions)
Mirna reaction buffer mix, by Takara Bio (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Minibest universal rna extraction kit, by Takara Bio (2 mentions)
Sybr premix ex taq kit, by Takara Bio (2 mentions)
Rt for pcr kit, by Takara Bio (1 mentions)
Sybr green mix, by Selleck Chemicals (1 mentions)
Cfx connect instrument, by Bio-Rad (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Lightcycler lc480 instrument, by Roche (1 mentions)
T100 thermal cycler, by Bio-Rad (1 mentions)
Total exosome rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
Total rna extraction kit, by Thermo Fisher Scientific (1 mentions)
28 protocols using primescript rt enzyme mix
1
Liver RNA Extraction and qRT-PCR
2
Osteogenic Differentiation of MC3T3-E1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MC3T3-E1 cells were treated with or without EPC-MVs or EPC-MVs-miR126 in OIM condition for 14 days. Total RNA was isolated as described above. Total RNA (1 μg) was reverse-transcribed into cDNA using PrimeScript RT Enzyme mix (Takara Bio Inc., Shiga, Japan) at 37°C for 15 min, followed by an 85°C incubation for 5 s. Osteogenic-specific primers such as Runx2, Osteopontin (OPN) and Osteocalcin (OCN) were detected. GAPDH was used as an internal control. Fold change in gene expression was calculated based on the normalized mean differences method.
3
Quantitative analysis of IL-17 pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent according to the manufacturer’s instructions (Invitrogen, Carlsbad, USA) and was converted into cDNA with random hexamers and PrimeScript RT Enzyme Mix (TaKaRa, Guangzhou, China). HPRT was used as an internal control. The messenger RNA (mRNA) levels of IL-17 and its related factors were analyzed through quantitative real-time RT-PCR (qRT-PCR). These IL-17-related factors were IL-17A, IL-17F, ROR-γt, IL-23R, CCR6, and granulocyte–macrophage colony-stimulating factor (GM-CSF). The mRNA levels of target genes were quantified using SYBR green mix (Bimake, Guangzhou, China) and the CFX Connect™ instrument (Bio-RAD, Guangzhou, China). The relative mRNA levels of multiple cytokine genes in each sample were displayed as 2−ΔΔCt values and were representative of at least three independent experiments.
4
Chondrogenic Differentiation Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After chondrogenic differentiation for seven days, total RNA from human cells was extracted using Trizol (three replicates for each group) to perform real-time quantitative reverse transcription (qRT-PCR). Total RNA was used as the template to reverse transcribe complementary DNA (cDNA) using Prime Script RT Enzyme mix (Takara, Kusatsu, Japan). Quantitative real-time polymerase chain reaction (qPCR) was performed with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) by Step-One-Plus Real Time PCR Systems (Thermo Fisher Scientific) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression was used as internal control. Primer sequences were determined by GenBank sequences. The sequences are listed below: GAPDH forward: 5’AGGGCTGCTTTTAACTCTGGTAAA3’, reverse: 5’GAATTTGCCATGGGTGGAAT 3’; Sox9 forward: 5’CAGAACACCAGCAGTTAA3’, reverse: 5’AACAACAGATGACCATACC3’; Aggrecan (Acan) forward: 5’ CAGAATCAACTGCTGCAGACCA3’, reverse: 5’ TTCGATGGTCCTGTCGTTCAG3’; Collagen type II α 1(Col 2a1) forward: 5’GGCAATAGCAGGTTCACGTACA3’, reverse: 5’CGATAACAGTCTTGCCCCACTT3’.
5
Extraction and Quantification of Linc00665 in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from fresh frozen tumor tissues (collected by the core-needle biopsy in breast cancer patients before neoadjuvant chemotherapy) utilizing TRIzol™ Reagent (Invitrogen) according to the manufacturer’s instructions. We evaluated RNA concentration and purity by using spectrophotometry (Nano-Drop Technologies, Wilmington, Delaware, USA) and then synthesized random-primed cDNA using PrimeScript RT Enzyme Mix (Takara RR036A) on a nucleic acid amplification machine (BIO RAD, T100™ Thermal Cycler), setting the operational procedure at 37°C for 30 min and 85°C for 10 s. Linc00665 levels were detected by SYBR Green qPCR (Roche) employing a LightCycler LC480 instrument (Roche) according to the following procedures: 95°C for 5 min and 42 cycles at 95°C for 10 s, and 60°C for 1 min. We triplicated each cDNA sample in 384-microwell plates. The β-actin was employed as internal control to normalize tests. The expression of Linc00665 was calculated using the 2-△△Ct method. Primer sequences are listed in Table S1
6
Quantifying Circular FNDC3B in ESCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ESCC tissues or cells by TRIzol method. 1.0 µg total RNA was obtained. cDNA was synthesized by PrimeScript RT enzyme Mix (TaKaRa, Japan). U6 and β-actin were applied as endogenous control genes for miRNA and mRNA, respectively. PCR reaction and data analysis were performed in ABI StepOnePlus /ABI 7500 (Thermo Fisher, USA). The relative levels were computed by 2-ΔΔCt. The sequences of primers were as follows:
circFNDC3B: F: 5′-TTCAGACTTGCAAGGTGATTGAAG-3′;
R: 5′-ATACTGTTGTGCAGCTGCTTTT-3′;
liner FNDC3B: F: 5′-ACTGAAAGACCGCCAGATCG-3′;
R: 5′-TCTTGCTCGTCGCTCTGTTT-3′;
miR-370-3p: F: 5′-GCCTGCTGGGGTGGAACCTGGT-3′;
R: 5′-GCAGGGTCCGAGGTATTC-3′;
miR-136-5p: F: 5′-GCCTGGCTGGACAGAGTTG-3′;
R: 5′-GGCTGGGTTGTCATGTGACT-3′;
MYO5A: F: 5′-AGAGAAGTGGGCCTTCTGGT-3′;
R: 5′-GAGCTTCCAAGCCACTTCTG-3′;
β-actin: F: 5′-ATCACTGCCACCCAGAAGAC-3′;
R: 5′-TTTCTAGACGGCAGGTCAGG-3′;
U6: F: 5′-CTCGCTTCGGCAGCACA-3′;
R: 5′-AACGCTTCACGAATTTGCGT-3′.
circFNDC3B: F: 5′-TTCAGACTTGCAAGGTGATTGAAG-3′;
R: 5′-ATACTGTTGTGCAGCTGCTTTT-3′;
liner FNDC3B: F: 5′-ACTGAAAGACCGCCAGATCG-3′;
R: 5′-TCTTGCTCGTCGCTCTGTTT-3′;
miR-370-3p: F: 5′-GCCTGCTGGGGTGGAACCTGGT-3′;
R: 5′-GCAGGGTCCGAGGTATTC-3′;
miR-136-5p: F: 5′-GCCTGGCTGGACAGAGTTG-3′;
R: 5′-GGCTGGGTTGTCATGTGACT-3′;
MYO5A: F: 5′-AGAGAAGTGGGCCTTCTGGT-3′;
R: 5′-GAGCTTCCAAGCCACTTCTG-3′;
β-actin: F: 5′-ATCACTGCCACCCAGAAGAC-3′;
R: 5′-TTTCTAGACGGCAGGTCAGG-3′;
U6: F: 5′-CTCGCTTCGGCAGCACA-3′;
R: 5′-AACGCTTCACGAATTTGCGT-3′.
7
Extraction and Quantification of Total RNA from Exosomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using a total RNA extraction kit (K156002, Invitrogen, CA, USA) according to the manufacturer’s guidelines. Total RNA was isolated from BMSCs-exosomes and chondrogenic BMSCs-exosomes using a total exosome RNA isolation kit (4478545, Invitrogen, CA, USA) according to the manufacturer’s guidelines. The RNA concentrations were detected by NanoDrop (Thermo Scientific, MA, USA). About 500 ng RNA was reverse transcribed into cDNA with PrimeScript RT Enzyme Mix (DRR037A, TaKaRaBio, Beijing, China) according to the manufacturer’s guidelines.
8
Quantification of miR-503 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miR-503 and U6 primers were purchased from Takara Bio (Otsu, Japan). Total miRNA was extracted from cultured cells and human tissue specimens with RNAiso for Small RNA (Takara Bio), according to the manufacturer’s instructions. PolyA tails were added to miR-503 and U6 with the miRNA Reaction Buffer Mix (Takara Bio) and cDNA was synthesised from 5 ng total RNA using the miRNA PrimeScriptRT Enzyme Mix (Takara Bio). Quantitative polymerase chain reaction (qPCR) was run on a CFX96™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) with SYBR® Premix Ex Taq™ II (Takara Bio). The qPCR conditions were as follows: 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec, then 60°C for 30 sec. The data were normalised against the U6snRNA. Subsequent to amplification, a melting curve analysis was performed to ensure the specificity of the products.
9
One-Step RT-qPCR for Viral RNA/DNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RT-qPCR assay was conducted using the One Step PrimeScript™ RT-PCR Kit (TaKaRa), with some modifications. After optimization, the 20-μL reaction mixtures contained 2 μL viral RNA or DNA, 10 μL 2X One-Step RT-PCR Buffer Ⅲ, 0.4 μL TaKaRa Ex Taq HS (5 U/μL), 0.4 μL PrimeScript RT Enzyme Mix Ⅱ, 0.4 μL ROX Reference Dye, 0.8 μL each pair of primers, 0.8 μL probe (10 μM) and 4.4 μL nuclease-free water. Thermal cycling conditions involved an initial 5 min incubation at 42 °C, then 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s and 57 °C for 20 s. The reaction was carried out using QuantStudio 5 Real-Time PCR System (Real-Time PCR System, Waltham, MA, USA).
10
Quantifying AtTMN1 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length transcripts of AtTMN1 were detected by reverse transcription PCR. Plants were grown in solid media containing 100 μM boric acid for 11 d. Total RNA was extracted from leaves and roots using the RNeasy Plant Mini Kit (Qiagen, Germany). cDNA was synthesized using Prime Script RT Enzyme Mix (Takara, Japan). cDNA of AtTMN1 and Actin1 (cDNA quality control) were amplified using KOD-Plus-Neo (Toyobo, Japan) with specific primers P8 and P9 for AtTMN1, and P10 and P11 for Actin1 (Supplementary Table S5 ). cDNA from 5 ng (for AtTMN1 and Actin1 in rosette leaves), 10 ng (for AtTMN1 in roots), and 1 ng (for Actin1 in roots) of total RNA was used as template; 40 cycles of amplification were performed.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!