The largest database of trusted experimental protocols

Epitect chip qpcr primer

Manufactured by Qiagen
Sourced in Germany

The EpiTect ChIP qPCR primers are a set of pre-designed primer pairs for use in quantitative real-time PCR (qPCR) analysis of chromatin immunoprecipitation (ChIP) samples. The primers are designed to amplify specific genomic regions of interest, allowing for the quantification of DNA enrichment following the ChIP procedure.

Automatically generated - may contain errors

14 protocols using epitect chip qpcr primer

1

Quantifying Protein-DNA Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols
After chromatin immunoprecipitation reaction, 5 μl of each DNA sample were added per well in 96 well plate for RT-qPCR. Each sample was run in triplicate and a standard curve was prepared for each primer pair using input DNA. Input DNA refers to the purified DNA after sonication, but before the ChIP reaction. EpiTect ChIP qPCR primers for specific promoters were purchased from Qiagen. Fast SYBR green master mix was from ABI. Fold enrichment was calculated by finding the slope of the standard curve, solving for the DNA quantity of each sample, and finally determining the fold enrichment of the ChIP sample relative to the IgG sample.
+ Open protocol
+ Expand
2

Immunoprecipitation and ChIP Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunoprecipitation and GST pull down assays were essentially performed as previously described [37 (link)]. To avoid masking signals by IgG, we used True blot IP beads (eBioscience). ChIP assay was performed using the Simple ChIP enzymatic Chromatin IP kit (Cell Signaling) according to manufacturer’s instructions. The Epitect ChIP qPCR primers for NF-κB binding sites for c-Myc and Frap1 were purchased from Qiagen.
+ Open protocol
+ Expand
3

ChIP-qPCR Assay for Chromatin Immunoprecipitation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blot was carried out as previously described (5 (link)). Chromatin was prepared using truChIP Low Cell Chromatin Shearing Kit (Covaris) and sheared into 200–700 bp fragments using a Covaris S2 instrument (duty cycle, 2%; intensity, 3; 200 cycles per burst; 4 min). Immunoprecipitation was performed using the IgG, p53 (FL-393), E2F-1 (C-20) and H4R3 (Abcam) antibodies with a Quick Chip Kit (Imgenex, San Diego, CA). Quantification of the precipitated DNA was determined with qPCR (Qiagen, QuantiTect SYBR Green Mastermix) and normalized with the input genomic DNA. Primers used are: Apaf-1 (E2F-1) forward, 5′-TAGTTTTGTAGGCACACAGCTCTAAATAGGAG-3′, Apaf-1 (E2F-1) reverse, 5′-CGGATGAGTTTGCTCACACCCTCCACC-3′; Pmaip1 (E2F-1) forward, 5′- GCCCCAGCAATGGATACGA −3′, Pmaip1 (E2F-1) reverse, 5′- TGCTCAACCCCCAAATTGCT −3′. The other primers are from Qiagen EpiTect ChIP qPCR Primers.
+ Open protocol
+ Expand
4

Chromatin Immunoprecipitation Protocol for RelA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were grown to 80% confluence, and crosslinking was performed with 1% formaldehyde for 10 min. ChIP assays were performed using a Magna ChIP G Chromatin Immunoprecipitation Kit (Millipore) according to the manufacturer’s instructions. After immunoprecipitation with an antibody to RelA (Cell Signaling Technology, 8242) or normal rabbit IgG, protein-DNA crosslinks were reversed. DNA was then purified to remove the chromatin proteins and analysed by quantitative real-time PCR using the Qiagen EpiTect ChIP qPCR Primers (Cat# GPH1006956(-)01A).
+ Open protocol
+ Expand
5

Chromatin Immunoprecipitation of Sox9 in Chondrocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
shRNA‐Transduced ATDC5 cells (approximately 5 × 10 6) were cross‐linked with 1% formaldehyde (10 min at room temperature). ChIP assays were performed using the ChIP‐Express Enzymatic Kit (Active Motif, Inc.) according to the manufacturer's instructions. Briefly, chromatin was enzymatically sheared to an average size of approximately 300 bp and incubated with 2 μg of control IgG (Active Motif, Inc.) or antibody specific to SOX9 (Abcam, Cambridge, UK), and 25 μL of protein G magnetic beads overnight at 4°C. After reversal of cross‐linking and protein digestion with proteinase K, immunoprecipitated DNA was purified with the MiniElute PCR Purification Kit (QIAGEN), and PCR was performed using a SYBR Green ROX Master Mix (QIAGEN) according to the following parameters: enzyme activation, 95°C for 2 min, and then 40 cycles of 95°C for 15 s and 60°C for 1 min. EpiTect ChIP qPCR primers (QIAGEN) for the putative SOX9 binding site were used to amplify the target enhancer region within the Acan (GPM10391229‐05 kb) and Col2a1 (GPM1046416 + 03 kb) genes. Each probe represented a pool of primers that amplify many different amplicons around that region. For Col2a1, this is a region +3 kb from the transcription start site (TSS; Active Motif, Inc.) and for Acan this is a region –5 kb from the TSS. Both regions include previously described SOX9 binding sites.
+ Open protocol
+ Expand
6

Chromatin Immunoprecipitation (ChIP) Assay for ER Stress Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were carried out using EZ ChIP kit (Millipore) according to the manufacturer's protocol with some modifications. 293T cells were treated with Tm or Tg prior to cross-linking. DNA fragments at around 200-1000 bp were achieved by sonication with Microson Ultrasonic Cell Disruptor (Misonix). For IP, the indicated antibodies (i.e. anti-XBP-1 or anti-PCAF antibodies) were added to the sheared chromatin individually and incubated at 4°C overnight. The DNA/protein/antibody complex was then pulled down by protein G agarose and the DNA in the complex was purified using QIAquick PCR purification kit (Qiagen). Quantitative-PCR was performed to determine the relative amount of DNA that was immunoprecipitated by anti-XBP-1 or anti-PCAF antibodies in the presence of Tm or Tg. The primer pairs used to amplify the promoter regions of BiP, CHOP and EDEM genes include: BiP (5′-GATGGGGCGGATGTTATCTA-3′ and 5′-CTCTCACACTCGCGAAACAC-3′), CHOP (5′-GACACTACGTCGACCCCCTA-3′ and 5′-GGTTCCAGCTCTGATTTTGG-3′), and EDEM (Epitect ChIP qPCR primers, Qiagen). Cells treated with DMSO served as a negative control. For overexpression, MCF7 cells were co-transfected with the indicated expression vectors two days prior to cross-linking, followed by ChIP-quantitative-PCR as described earlier.
+ Open protocol
+ Expand
7

ChIP-qPCR for c-MYC and Nanog in Sca-1+ cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was performed using the Magnify chromatin IP kit (#1626969, Invitrogen, CA) according to manufacturer instructions. Briefly, Sca-1+ cells were fixed with 1% formaldehyde, sonicated to produce DNA fragments of approximately 100–600bp and then subjected to immunoprecipitation (19 (link)) with c-MYC (2 ug, N-262, # sc-764, Santa Cruz, TX) as well as isotype matched control for rabbit IgG (NB810–56910; Novus Biologicals, CO) as previously described (42 (link)). The mouse and human DNA products were subjected to SYBR green PCR using EpiTect ChIP qPCR primers (SABiosceince, Qiagen, Valencia, CA). Results were analyzed using percent input method, where 1% of starting chromatin was used as input (42 (link)). For re-ChIP analysis, chromatin products from first IP were treated with 10mM DTT for 30 minutes at 370C to prevent the majority of the first antibody from participating in the second IP reaction. Eluates were diluted in dilution buffer and then used for second IP by Nanog (#5232, Cell Signaling, MA) rabbit antibody, as described (42 (link)).
+ Open protocol
+ Expand
8

Chromatin Shearing and Immunoprecipitation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The truChIP Chromatin Shearing Kit (Covaris) was used to prepare chromatin. Chromatin was sheared into 200- to 700-bp fragments using a Covaris S2 instrument (duty cycle, 2 %; intensity, 3; 200 cycles per burst; 4 min). The IgG and NF-kB p65 antibodies (2A12A7, Thermo Fisher) were used for immunoprecipitation by the Quick Chip Kit (Imgenex SYBR Green Master Mix, (Appliedbiosystems) was used for qPCR to quantify precipitated DNA). The primers are from Qiagen EpiTect ChIP qPCR primers.
+ Open protocol
+ Expand
9

Transcription Factor Binding Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP experiments (triplicates) used primers specific for IRF1 consensus binding sites, IRF-E, in the promoter regions of TRAIL (TNFSF10), STAT1 (STAT1), caspase 1 (CASP1), caspase 7 (CASP7), and NFκB p65 (RELA), as reported and indicated in sequence databases from TRANSFAC (http://www.gene-regulation.com/pub/databases.html) and SABiosciences (EpiTect ChIP qPCR Primers, Qiagen)28 (link),71 (link). Briefly, samples were immunoprecipitated (5 μg/ml) with specific or nonspecific antibody. ChIP-enriched chromatin (2–5 μl) was subjected to ChIP-PCR and enriched regions were assessed relative to control IgG or reference cells. Re-ChIP experiments were performed by using the Re-ChIP-IT Magnetic Chromatin RE-Immunoprecipitation kit according to the manufacturer’s protocol (Active Motif, Carlsbad, CA, USA).
+ Open protocol
+ Expand
10

Adipose Tissue Histone Methylation Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Histone protein was extracted from adipose tissue treated with Nnmt ASO and control ASO using the EpiQuik Total Histone Extraction Kit from Epigentek. Eight types of histone methylation were measured by western blot analysis using the following antibodies: H3K4me2, H3K9me2, H3K27me2, H3K36me2 and H3K79me2 from Cell Signaling; and H3K4me1, H3K4me3 and H3K9me3 from Abcam. The levels of histone methylation were normalized to total H3 expression. For ChIP, chromatin was first extracted from 3T3-L1 adipocytes treated with or without 10 mM N-methylnicotinamide for 48 h. Immunoprecipitation was performed using EpiQuik Methyl-Histone H3-K4 ChIP kit from Epigentek. Enrichment of methylated H3K4 on Odc and Ssat genes was measured by real-time PCR using EpiTect ChIP qPCR primers from Qiagen (Odc, GPM1030188(+)01A; Ssat, GPM1055920(+)01A). An open reading frame free region (Igx1a) was used as a negative control for ChIP-qPCR. Control IgG showed minimum background among all the regions analysed.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!