Total RNA was extracted from 80 mg rapeseed bee pollen using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Quantitative RT-PCR was performed using Taqman miRNA probes (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions. To calculate the absolute expression levels of target miRNAs, a series of synthetic miRNA oligonucleotides at known concentrations were reverse transcribed and amplified. The absolute amount of each miRNA was then calculated with reference to the standard curve. Quantitative PCR was performed using an ABI-StepOnePlus machine (Applied Biosystems).
Taqman mirna probes
Manufactured by Thermo Fisher Scientific
Sourced in United States
TaqMan miRNA probes are a set of genetic analysis tools designed to detect and quantify microRNA (miRNA) molecules. They provide a sensitive and specific method for miRNA expression analysis. The probes utilize TaqMan technology, which involves the use of a fluorescent reporter dye and a quencher dye to monitor the amplification of target miRNA sequences in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (32 mentions)
Amv reverse transcriptase, by Takara Bio (11 mentions)
Stem loop rt primer, by Thermo Fisher Scientific (10 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (9 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Sybr green dye, by Thermo Fisher Scientific (5 mentions)
Taqman pcr kit, by Thermo Fisher Scientific (5 mentions)
Applied biosystems 7300 sequence detection system, by Thermo Fisher Scientific (5 mentions)
Mirneasy mini kit, by Qiagen (4 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Avian myeloblastosis virus reverse transcriptase, by Takara Bio (3 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (3 mentions)
Nanodrop, by Thermo Fisher Scientific (3 mentions)
Taqman universal master mix 2, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Qiagen (2 mentions)
7300 sequence detection system, by Thermo Fisher Scientific (2 mentions)
Taqman mirna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Applied biosystems 7500 sequence detection system, by Thermo Fisher Scientific (2 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (2 mentions)
62 protocols using taqman mirna probes
1
Quantifying Rapeseed Bee Pollen miRNAs
2
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s instructions. For mRNA detection, first-strand cDNA was synthesized with 1 μg total RNA using the High Capacity Reverse Transcriptase (Applied Biosystems; Grand Island, NY, USA). qRT-PCR was performed using the SYBR Green PCR Master Mix with specific TaqMan Assay probes (Thermo Fisher Scientific; Waltham, MA, USA) or pre-designed primers on an ABI 7500 fast PCR system (Applied Biosystems). To quantify miRNA levels, TaqMan MicroRNA Reverse Transcription Kit and TaqMan Fast Universal PCR Master Mix were used with specific TaqMan miRNA probes (Applied Biosystems). Amplifications were carried out with an initial denaturation at 95°C for 20 s, followed by 40 cycles of 95°C for 3 s and 60°C for 30 s. Relative mRNA or miRNA expression was calculated against GAPDH, actin, or U6 rRNA using the ΔΔCt method.
3
Quantification of miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the cultured cells, exosomes, and tissues was isolated with TRIzol reagent (Invitrogen) according to the manufacturer’s protocols. The cDNA was obtained via avian myeloblastosis virus (AMV) reverse transcriptase (TaKaRa), which was conducted as follows: 16°C for 30 min, 42°C for 30 min, and 85°C for 5 min. Subsequently, quantitative real-time PCR was initiated by a 5-min hold at 95°C; then the cDNA was denatured at 95°C for 15 s followed by annealing/extension at 60°C for 1 min, which was performed for 40 cycles. TaqMan miRNA probes (Applied Biosystems, Foster City, CA, USA) were used to quantitate miRNA. After the reactions were completed, the cycle threshold (CT) data were determined using fixed threshold settings, and the mean CT values were determined from triplicate PCRs. The formula was adopted to calculate the relative quantities of target genes. U6 small nuclear RNA (snRNA) was used as an internal control for the miRNAs; GAPDH was used for normalization of the FOXO3a mRNA levels. The GAPDH and FOXO3a primers were designed as follows: 5′-AGAAGGCTGGGGCTCATTTG-3′ (GAPDH, sense); 5′-AGGGGCCATCCACAGTCTTC-3′ (GAPDH, anti-sense); 5′-GAAGAACTCCATCCGGCACA-3′ (FOXO3a, sense); and 5′-GCTCTTGCCAGTTCCCTCAT-3′ (FOXO3a, anti-sense).
4
Quantitative Analysis of Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated using the General AllgGen Kit (Cwbio, China) according to the manufacturer’s protocol. Total RNA was extracted using RNAiso reagent (Takara, Japan). The concentrations of DNA and RNA were determined using NanoDrop 2000 (Thermo, USA).
Complementary DNA (cDNA) was synthesized using the PrimeScript RT reagent kit (TaKaRa, Japan). QRT-PCR analyses were conducted to quantitate the relative mRNA expression using SYBR Premix Ex Taq (TaKaRa), with β-actin as an internal control. Stem-loop qRT-PCR assays using TaqMan miRNA probes (Applied Biosystems, USA) were performed to quantify the levels of the mature miRNAs. The reactions were incubated in 96- or 384-well optical plates at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. After the reactions, the cycle threshold (Ct) data were determined using default threshold settings, and the mean Ct was determined from the duplicate PCRs. A comparative ΔCt method was used to compare each condition with the controls, and the values are expressed as 2−△Ct. The relative levels of miRNAs were normalized to the levels of U6, a ubiquitously expressed small nuclear RNA. The relative DNA copy numbers were determined as described previously (Wang et al., 2002 (link)).
Complementary DNA (cDNA) was synthesized using the PrimeScript RT reagent kit (TaKaRa, Japan). QRT-PCR analyses were conducted to quantitate the relative mRNA expression using SYBR Premix Ex Taq (TaKaRa), with β-actin as an internal control. Stem-loop qRT-PCR assays using TaqMan miRNA probes (Applied Biosystems, USA) were performed to quantify the levels of the mature miRNAs. The reactions were incubated in 96- or 384-well optical plates at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. After the reactions, the cycle threshold (Ct) data were determined using default threshold settings, and the mean Ct was determined from the duplicate PCRs. A comparative ΔCt method was used to compare each condition with the controls, and the values are expressed as 2−△Ct. The relative levels of miRNAs were normalized to the levels of U6, a ubiquitously expressed small nuclear RNA. The relative DNA copy numbers were determined as described previously (Wang et al., 2002 (link)).
5
Quantitative RT-PCR Analysis of Serum miRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used TaqMan miRNA probes (Applied Biosystems) to perform qRT–PCR assays according to the manufacturer’s instructions. In brief, 2 ul aliquot of enriched small RNAs from serum samples were reverse transcribed using the Taq-Man MicroRNA Reverse Transcription Kit (Applied Biosystems, San Diego, CA). Then 2 ul of the cDNA solution was used as template for the PCR stage. PCR reaction was performed using 10 ml TaqMan Universal Master Mix (2×) (Applied Biosystems, USA), 1 ul gene-specific probe, and nuclease-free H2O in a final volume of 20 ul. No-template controls for both RT step and PCR step were included to ensure target specific amplification. All reactions were run in duplicate. The CT values of the different samples were compared using the ∆∆CT method [23 (link)]. The relative expression levels of target miRNAs were normalized by cel-miR-54.
6
Quantitative RT-qPCR for c-Met and GAPDH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AMV reverse transcriptase (TaKaRa, China) was used to reverse-transcribe the total RNA. Subsequently, miRNA and mRNA were quantified with TaqMan miRNA probes (Applied Biosystems, USA) or SYBR Green dye (Ambion, USA), respectively. The cycle threshold (CT) was acquired using fixed settings. U6 or GAPDH was used as an internal control. The relative levels of miRNA or mRNA were calculated using the equation 2–△△CT. qPCR primers were as the following: c-Met FP: 5′-CGACAGCTGACTTGCTGAGA-3′, c-Met RP: 5′-AGGTTTATCTTTCGGTGCCCA-3′; GAPDH FP: 5′-GATATTGTTGACATCAATGAC-3′, GAPDH RP: 5′-TTGATTTTGGAGGGATCTCG-3′.
7
Serum miRNA Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used TaqMan miRNA probes (Applied Biosystems) to perform qRT-PCR assays according to the manufacturer's instructions. Briefly, 2 μL aliquot of enriched small RNAs from serum samples was reverse transcribed using the Taq-Man MicroRNA Reverse Transcription Kit (Applied Biosystems, San Diego, CA). Then 2 μL of the cDNA solution was used as template for the PCR stage. No-template controls for both RT step and PCR step were included to ensure target specific amplification. All reactions were run in duplicate. The CT values of the different samples were compared using the ΔΔCT method [20 (link)].The relative expression levels of target miRNAs were normalized by cel-miR-54.
8
Quantification of Mature miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Assays to quantify mature miRNAs were conducted as previously described, with slight modifications43 44 (link). Total RNA was extracted from the cultured cells and tissues using TRIzol Reagent (Invitrogen) according to the manufacturer's instructions. miRNA determination was performed using Taqman miRNA probes (Applied Biosystems, Foster City, CA). All of the reactions were run in triplicate. After the reactions were complete, the cycle threshold (CT) data were determined using fixed threshold settings and the mean CT was determined from triplicate PCRs. A comparative CT method was used to compare each condition to the control reactions. U6 small nuclear RNA was used as an internal control of miRNAs and the mRNA levels were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The relative amount of gene normalized to control was calculated with the equation 2−ΔCT, in which ΔCT=CT gene−CT control.
Primers of HGF and GAPDH were as follows: 5′-AGAAGGCTGGGGCTCATTTG-3′ (GAPDH, sense), 5′-AGGGGCCATCCACAGTCTTC-3′ (GAPDH, anti-sense); and 5′-CCTGGTGCTACACGGGAAAT-3′ (HGF, sense), 5′-CACATCCACGACCAGGAACA-3′ (HGF, anti-sense).
Primers of HGF and GAPDH were as follows: 5′-AGAAGGCTGGGGCTCATTTG-3′ (GAPDH, sense), 5′-AGGGGCCATCCACAGTCTTC-3′ (GAPDH, anti-sense); and 5′-CCTGGTGCTACACGGGAAAT-3′ (HGF, sense), 5′-CACATCCACGACCAGGAACA-3′ (HGF, anti-sense).
9
Quantification of miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cultured cells and tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). In order to detect the quantity of the miRNA, we used TaqMan miRNA probes (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's protocol. RNA was reverse transcribed into cDNA by using AMV reverse transcriptase (TaKaRa, Dalian, China) and a stem‐loop RT primer (Applied Biosystems). The reaction conditions were: 16°C for 30 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. Using a TaqMan PCR kit, RT‐PCR was carried out on ABI 7300 Sequence Detection System (Applied Biosystems). After the reactions were complete, the CT data were collected by using fixed threshold settings, and the mean CT was calculated from triplicate PCRs. A comparative CT method was used to compare each condition to the control reactions. U6 snRNA was used as an endogenous control; the mRNA levels of TGFβR2 were normalized to the endogenous control gene GAPDH. The relative amount of gene normalized to control was calculated with the equation 2−ΔCT, in which ΔCT = CT gene−CT control. All of the reactions were run in triplicate. The sequences of the primers for TGFβR2 and GAPDH were as follows: GAPDH sense, 5′‐AGAAGGCTGGGGCTCATTTG‐3′; GAPDH antisense, 5′‐AGGGGCCATCCACAGTCTTC‐3′; TGFβR2 sense, 5′‐GTAGCTCTGATGAGTGCAATGAC‐3′; and TGFβR2 antisense, 5′‐CAGATATGGCAACTCCCAGTG‐3′.
10
Comprehensive Adipogenesis Research Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FBS (cat# 16000-044), TRIzol reagent (cat# 15596-018), DMEM/F-12
(cat# 11330-032), and DMEM (cat# 11965-092) were purchased from
Invitrogen (Carlsbad, CA, USA). SYBR-Green fluorescent dye (cat# 4368577)
and TaqMan miRNA probes were purchased from Applied Biosystems (Foster City, CA,
USA). Collagenase type II (cat# c6885), oligomycin (cat# 75351), FCCP
(cat# C2920), rotenone (cat# R8875), indomethacin (cat# I-7378),
dexamethasone (cat# D-1756), isobutylmethylxanthine (cat# I-5879),
rosiglitazone (cat# R-2408), T3 (cat# T-2877) and the MystiCq microRNA
qPCR Assay (cat# MIRRM02) were purchased from Sigma (Deisenhogfen,
Germany).
For western blotting, anti-UCP1 antibody (cat# 14670) was purchased from Cell
Signaling Technologies (Danvers, MA, USA), anti-PRDM16 antibody (cat#
AF6295) was purchased from R&D Systems (Tustin, CA, USA)21 (link),
the anti-GAPDH antibody (cat# sc-25778) was purchased from Santa Cruz
Biotechnology (Santa Cruz, CA, USA)38 (link). For immunohistochemistry,
anti-UCP1 antibody (cat# ab10983) was purchased from Abcam (Cambridge, MA,
USA)39 (link). The antibodies used for flow cytometry, including
anti-CD45 (cat# 103121), CD11b (cat# 101207), and F4/80 (cat#
123115)26 (link), were purchased from BioLegend (San Diego, CA,
USA).
(cat# 11330-032), and DMEM (cat# 11965-092) were purchased from
Invitrogen (Carlsbad, CA, USA). SYBR-Green fluorescent dye (cat# 4368577)
and TaqMan miRNA probes were purchased from Applied Biosystems (Foster City, CA,
USA). Collagenase type II (cat# c6885), oligomycin (cat# 75351), FCCP
(cat# C2920), rotenone (cat# R8875), indomethacin (cat# I-7378),
dexamethasone (cat# D-1756), isobutylmethylxanthine (cat# I-5879),
rosiglitazone (cat# R-2408), T3 (cat# T-2877) and the MystiCq microRNA
qPCR Assay (cat# MIRRM02) were purchased from Sigma (Deisenhogfen,
Germany).
For western blotting, anti-UCP1 antibody (cat# 14670) was purchased from Cell
Signaling Technologies (Danvers, MA, USA), anti-PRDM16 antibody (cat#
AF6295) was purchased from R&D Systems (Tustin, CA, USA)21 (link),
the anti-GAPDH antibody (cat# sc-25778) was purchased from Santa Cruz
Biotechnology (Santa Cruz, CA, USA)38 (link). For immunohistochemistry,
anti-UCP1 antibody (cat# ab10983) was purchased from Abcam (Cambridge, MA,
USA)39 (link). The antibodies used for flow cytometry, including
anti-CD45 (cat# 103121), CD11b (cat# 101207), and F4/80 (cat#
123115)26 (link), were purchased from BioLegend (San Diego, CA,
USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!