Zeb1 sirna

The ESCC cell lines (EC9706, TE1, Eca109, Kyse70 and Kyse450) and normal oesophageal epithelial cell Het‐1A kept in liquid nitrogen in our laboratory were cultured in RPMI‐1640 medium supplemented with 10% foetal bovine serum (FBS, Gibco Company), 100 μg/mL streptomycin (Sigma‐Aldrich) and 100 U/mL penicillin (Sigma‐Aldrich) in a humidified 5% CO₂ incubator at 37°C. ZEB1‐AS1 siRNA (#1 sense: AACUUCUAGCCUCUCUUUCAA, antisense: GAAAGAGAGGCUAGAAGUUCC; #2 sense: UUUAGGAAGGAAUUCAUGGCC, antisense: CCAUGAAUUCCUUC CUAAAUG), negative control (NC): 5′‐UUCUCCGAACGUGUCACGUTT‐3′ (sense); 5′‐ACGUGACACGUUCGGAGAATT‐3′ (antisense), ZEB1 siRNA (Santa Cruz company), control siRNA (Santa Cruz company), pcDNA3.1 empty vector and pcDNA3.1‐ZEB1 (ZEB1) were transfected to EC9706 and TE1 cells by Lipofectamine™ 2000 (Invitrogen Life Technologies) according to manufacturer's instruction.

Cell culture reagents, including FBS, antibiotic/antimycotic solution, Trypsin-EDTA solution, MEM, Leibovitz L-15 media and Opti-MEM were GIBCO products purchased from Invitrogen/Life Technologies (Grand Island, NY, USA). Chemicals used in buffer preparations and the following specific reagents were purchased from Sigma Chemical Company (St. Louis, MO, USA): 17β-estradiol (estrogen; E₂), tamoxifen (4-hydroxy-tamoxifen; Tam). Anti-human FXYD3, anti-human E-cadherin, anti-human ZEB1, and anti-human ER α primary and secondary antibodies and molecular weight markers for SDS-PAGE, and ZEB1 siRNa and siRNA transfection reagent were all purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).