Poly a polymerase

The 5′ and the 3′ rapid amplification of cDNA ends (5′/3′ RACE) was performed using the SMARTer^® 5′/3′ RACE kit (Takara Bio, Saint-Germain-en-Laye, France) using the standard protocol. Total RNA was obtained as described in the section “RNA extraction”. A list of primers can be found in Supplementary Table S1 (first 14 primers). Random primers were used for 5′-first-strand cDNA synthesis. In a second round of RACE experiments, RNA was poly(A)-tailed for 20 min using poly(A)-polymerase (Invitrogen™) before proceeding with 5′ and 3′ RACE protocol. Primer sequences can be found in Supplementary Table S1 (last 20 primers).

Total RNA (100 ng) was reverse transcribed in a final volume of 10 μl. The reaction mixture included 1 μl of 10x poly(A) polymerase buffer, 0.1 mM of ATP, 1 μM of RT-primer, 0.1 mM of each deoxynucleotide (dATP, dCTP, dGTP and dTTP), 100 units of SuperScript III reverse transcriptase (Invitrogen, USA) and 1 unit of poly(A) polymerase (New England Biolabs, USA). The reaction was then incubated at 42 °C for 1 hour, followed by enzyme inactivation at 95 °C for 5 minutes. The sequence of the reverse transcription primer was 5′-AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3′ (where V is A, C or G and N is A, C, G or T).

Prior to RNA isolation, 100 mg of tissue was spiked with 100 nM of a random RNA sequence (UUAAGGCACGCGGUGAAUGCCAGCAGUGGC). The miRNA was isolated by using the PureLink® miRNA Isolation Kit (Qiagen) according to the manufacturer’s instruction. The small RNA fraction was polyadenylated using poly(A) polymerase (NEB), and reverse transcribed using superscript III (Thermo Fisher Scientific) and a poly(T) adaptor primer as described in [57 (link)]. qRT-PCR was performed using SsoFast EvaGreen Supermix (Bio-Rad) in 10 μL reactions on a CFX384 (Bio-Rad) system. Thermocycling conditions for each miRNA was determined experimentally. In general, thermocycling conditions were as followed: 95 °C for 2.30 min (1 cycle); 95 °C for 15 s, 60 °C for 30 s, 72 °C for 30 s (40 cycles), followed by a dissociation curve analysis of 65–95 °C at 0.5 °C per cycle. Quantification was performed using the 2^-∆CT method, with miRNA expression normalised relative to the random RNA sequence. The primer sequences used for qPCR analysis can be found in Additional file 2: Table S1.

After determining that virus-specific inserts from one plasma sample were presumably from OROV vRNA, a gene walking approach was used to sequence the virus, and 5/3 RACE was used to obtain the 5’ and 3’ end sequences by Sanger sequencing. Briefly, targeted overlapping (tiled) sequences (< 800 bp amplicons) were amplified using Accuscript High Fidelity reverse transcriptase in the presence of SUPERase-In RNase inhibitor (Ambion, Austin, TX), followed by PCR with Q5 high-fidelity DNA polymerase (New England Biolabs) with denaturation steps performed at 98°C. The primers that were optimized for the gene walking sequencing approach are listed in S2 Table; red letters denote nucleotide differences from the corresponding sequence in the reference strain. To obtain the 5′ and 3′ ends of the three OROV genomes, a 5′ and 3′ system for the Rapid Amplification of cDNA Ends (RACE) was used per the manufacturer’s protocols (Life Technologies, Carlsbad, CA, USA); noteworthy, the 3’ vRNA ends were A-tailed using a Poly(A)-Polymerase (ThermoFisher Scientific, USA) prior to 3’ RACE. The PCR amplicons were purified, sequenced bi-directionally using Sanger Sequencing, and the resulting consensus sequences assembled with the aid of Sequencher DNA sequence analysis software v2.1 (Gene Codes, Ann Arbor, MI, USA).