Lightcycler 480 basic software

Manufactured by Roche

Sourced in Switzerland

The LightCycler 480 Basic Software is a software package designed to operate the LightCycler 480 Real-Time PCR System, a laboratory instrument used for quantitative real-time PCR analysis. The software provides the core functionality to control the instrument, set up experiments, and analyze the resulting data.

Automatically generated - may contain errors

Lab products found in correlation

Lightcycler 480 real time pcr system, by Roche (3 mentions) Lightcycler 480, by Roche (2 mentions) Universal probe library assay design center, by Roche (2 mentions) Quantitect reverse transcription kit, by Qiagen (2 mentions) Taqman real time pcr assay, by Thermo Fisher Scientific (1 mentions) Gotaq probe qpcr master mix, by Promega (1 mentions) Dnase 1, by Thermo Fisher Scientific (1 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Lightcycler 480 sybr green 1 master, by Roche (1 mentions) Universal probe library platform, by Roche (1 mentions) Qiashredder spin column, by Qiagen (1 mentions) Universal probe library system, by Roche (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Rneasy plus mini kit, by Qiagen (1 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Ssoadvanced universal sybr green supermix, by Bio-Rad (1 mentions) Rneasy mini rna extraction kit, by Qiagen (1 mentions) Random hexanucleotides, by Thermo Fisher Scientific (1 mentions) Lightcycler 480 system, by Roche (1 mentions)

Spelling variants of this product

LightCycler 480 (7708 citations) LightCycler (1119 citations) LightCycler software (129 citations) LightCycler 480 Basic Software Version 1.5 (5 citations)

6 protocols using lightcycler 480 basic software

Genotyping of COL12A1 SNPs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping of COL12A1 SNPs rs970547 and rs240736 was performed by real-time PCR using TaqMan probes and analyzed using pre-designed Applied Biosystems TaqMan real-time PCR assays (Applied Biosystems, Foster City, CA, USA).
The reaction mix for each sample contained GoTaq^® Probe qPCR Master Mix (Promega, Madison, WI, USA), TaqMan real-time PCR assays (Applied Biosystems, Foster City, CA, USA), and nuclease-free, deionized water, strictly adhering to the manufacturer’s protocol.
The reaction mix, DNA, and no-template control (NTC) were pipetted into 384-well plates (Axygen Inc., Union City, CA, USA). Real-time PCR was performed on LightCycler^® 480 (Real-Time PCR System, Roche Diagnostics, Basel, Switzerland). Genotyping data were analyzed using LightCycler480 Basic Software (Version 1.5, Roche Diagnostics, Basel, Switzerland).

Dalewski B., Kaczmarek K., Jakubowska A., Szczuchniak K., Pałka Ł, & Sobolewska E. (2021). COL12A1 Single Nucleotide Polymorphisms rs240736 and rs970547 Are Not Associated with Temporomandibular Joint Disc Displacement without Reduction. Genes, 12(5), 690.

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from both non-confluent cultures of undifferentiated and differentiated cells at P3 using the TRIzol Reagent (Invitrogen). After treatment with DNase I (Ambion), first strand cDNA synthesis was performed with 1 µg total RNA using random hexanucleotides and MMLV reverse transcriptase (Invitrogen). Primers were designed from available human sequences using the primer analysis software Primer3 (Table S2). Quantitative RT-PCR was performed using Roche LightCycler 480 Real-Time PCR System and the LightCycler 480 SYBR Green I Master (Roche), following manufacturer’s instructions. HPRT was used as internal control for normalization. LightCycler 480 Basic software (Roche) utilized the second derivative maximum method to identify the crossing point (Cp).

Domenis R., Bergamin N., Gianfranceschi G., Vascotto C., Romanello M., Rigo S., Vagnarelli G., Faggiani M., Parodi P., Kelley M.R., Beltrami C.A., Cesselli D., Tell G, & Beltrami A.P. (2014). The Redox Function of APE1 Is Involved in the Differentiation Process of Stem Cells toward a Neuronal Cell Fate. PLoS ONE, 9(2), e89232.

+ Open protocol

+ Expand

qRT-PCR analysis of cell line transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate cDNA of mCFU‐E, BaF3‐EpoR, 32D‐EpoR cells, 1–2 μg of total RNA was transcribed with the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative RT–PCR was performed using a LightCycler 480 in combination with the hydrolysis‐based Universal Probe Library (UPL) platform (Roche Diagnostics). Crossing point (CP) values were calculated using the Second Derivative Maximum method of the LightCycler 480 Basic Software (Roche Diagnostics). PCR efficiency correction was performed for each PCR setup individually based on a dilution series of template cDNA. Relative concentrations were normalized using HPRT or RPL32 as reference genes. UPL probes and primer sequences were selected with the Universal ProbeLibrary Assay Design Center (Roche Diagnostics).

Gene name	Primer		UPL No
Gene name	Forward	Reverse	UPL No
CCND2	CTGTGCATTTACACCGACAAC	CACTACCAGTTCCCACTCCAG	45
CCNG2	CCACGCGATTGTATTTTGTC	AGCTGCGCTTCGAGTTTATC	15
CDKN1B	GAGCAGTGTCCAGGGATGAG	TCTGTTCTGTTGGCCCTTTT	62
DUSP4	GTACCTCCCAGCACCAATGA	GAGGAAAGGGAGGATTTCCA	17
DUSP5	GATCGAAGGCGAGAGAAGC	GGAAGGGAAGGATTTCAACC	102
DUSP6	TGGTGGAGAGTCGGTCCT	TGGAACTTACTGAAGCCACCT	66
RPL32	GCTGCCATCTGTTTTACGG	TGACTGGTGCCTGATGAACT	12
HPRT	TCCTCCTCAGACCGCTTTT	CCTGGTTCATCATCGCTAATC	95

Adlung L., Kar S., Wagner M., She B., Chakraborty S., Bao J., Lattermann S., Boerries M., Busch H., Wuchter P., Ho A.D., Timmer J., Schilling M., Höfer T, & Klingmüller U. (2017). Protein abundance of AKT and ERK pathway components governs cell type‐specific regulation of proliferation. Molecular Systems Biology, 13(1), 904.

+ Open protocol

+ Expand

RNA Isolation and Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were collected in RLT Plus lysis buffer and lysates were homogenized using QIAshredder spin columns (both Qiagen). Homogenized lysates were immediately placed on dry-ice and stored at –80°C until RNA isolation. RNA was extracted using the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions. Reverse transcription was performed using either the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) or the QuantiTect Reverse Transcription Kit (Qiagen). Diluted cDNA was analyzed applying the Universal ProbeLibrary System on a LightCycler 480 (both Roche), cycling conditions can be found in Appendix Table S2. Relative mRNA concentrations were calculated according to a cDNA dilution series with the Absolute Quantification Second Derivative Maximum method of the LightCycler 480 Basic Software (Roche). Target mRNA concentrations were normalized to the geometric mean of Hprt/Tbp concentrations or to Hprt concentrations. Primer/probe combinations were designed using the Universal ProbeLibrary Assay Design Center (Roche) and are listed in Appendix Table S3.

Sobotta S., Raue A., Huang X., Vanlier J., Jünger A., Bohl S., Albrecht U., Hahnel M.J., Wolf S., Mueller N.S., D'Alessandro L.A., Mueller-Bohl S., Boehm M.E., Lucarelli P., Bonefas S., Damm G., Seehofer D., Lehmann W.D., Rose-John S., van der Hoeven F., Gretz N., Theis F.J., Ehlting C., Bode J.G., Timmer J., Schilling M, & Klingmüller U. (2017). Model Based Targeting of IL-6-Induced Inflammatory Responses in Cultured Primary Hepatocytes to Improve Application of the JAK Inhibitor Ruxolitinib. Frontiers in Physiology, 8, 775.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Neuronal Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from neuronally differentiated cells using the RNeasy Mini RNA extraction kit (Qiagen) according to the manufacturer’s protocols. First strand cDNA synthesis was performed with 1ug RNA using random hexanucleotides (Invitrogen) and SuperScript III reverse transcriptase (Invitrogen). Quantitative RT-PCR was carried out in 15 μl reaction volume containing 1-3ul of obtained cDNA, SsoAdvanced Universal SYBR Green Supermix (BioRad) and gene-specific sense and anti-sense primers. HPRT was used as an internal control for normalization. Primer sequences are listed in Additional file 1: Table S1.
Quantitative RT-PCR was performed in a Roche 480 LightCycler Real-Time PCR System, following the manufacturer’s instructions. LightCycler 480 Basic software (Roche) utilized the second derivative maximum method to identify the crossing point (Cp).

Dardis A., Zampieri S., Canterini S., Newell K.L., Stuani C., Murrell J.R., Ghetti B., Fiorenza M.T., Bembi B, & Buratti E. (2016). Altered localization and functionality of TAR DNA Binding Protein 43 (TDP-43) in niemann- pick disease type C. Acta Neuropathologica Communications, 4, 52.

+ Open protocol

+ Expand

Quantitative RT-PCR Assays for Canine Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Assays for 13 canine genes and one reference gene (Table 1) were designed using methods previously reported (Clements et al., 2006) . Primers (MWG Biotech) and probes (Roche Diagnostics) were synthesised using locked nucleic acid with 5′-end labelled with a reporter fluorescein dye (FAM, 6-carboxy fluorescein) and 3′-end labelled with a dark quencher dye. In brief, quantitative RT-PCR assays were performed in triplicate in 96-well plates (LightCycler 480 system using Probes Masters; Roche Diagnostics) with one notemplate control for each sample with total reaction volume of 5 μL per well. The amplification was performed according to a standard protocol. Quantitative RT-PCR data were analysed using LightCycler 480 Basic Software (Roche Diagnostics).The reference genes was used to normalise target gene relative expression level and to calculate the -ΔΔCt values.

Lu C.C., Liu M.M., Culshaw G., Clinton M., Argyle D.J, & Corcoran B.M. (2015). Gene network and canonical pathway analysis in canine myxomatous mitral valve disease: a microarray study. Veterinary journal (London, England : 1997), 204(1).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!