Log In Sign up
The largest database of trusted experimental protocols

G 5 ppp 5 a rna cap structure analog

Manufactured by New England Biolabs
Visit Supplier

The G(5')ppp(5')A RNA cap structure analog is a synthetic compound that mimics the 5' cap structure found in eukaryotic messenger RNA (mRNA). This cap structure plays a crucial role in mRNA stability, nuclear export, and translation initiation. The G(5')ppp(5')A analog can be used in various in vitro and in vivo experiments to study the functional aspects of the mRNA cap structure.

Automatically generated - may contain errors

Lab products found in correlation

Smz 1500 zoom stereomicroscope, by Nikon (2 mentions) Phenol red, by Merck Group (1 mentions) Typhoon fla 7000, by GE Healthcare (1 mentions) Imagequant, by GE Healthcare (1 mentions) Mrna decapping enzyme, by New England Biolabs (1 mentions) Kaleidagraph, by Synergy Software (1 mentions) Sybr green 2, by Lonza (1 mentions)

Spelling variants of this product

G(5′)ppp(5′)G RNA cap structure analog (4 citations) Cap structure analog (4 citations) G RNA Cap Structure Analog (3 citations) G(5′)ppp(5′)A (2 citations)

4 protocols using g 5 ppp 5 a rna cap structure analog

1

Investigating THRβ Modulation in Toxicity

Check if the same lab product or an alternative is used in the 5 most similar protocols
THRβ translation blocking (GCAGTATGTCAGAGCAAGCAGACAA, THR-MO) and 5-bp mismatch control (GgAGaATGTCtGAGCtAGCtGACAA) morpholinos (Control- MO) were designed with Gene Tools, LLC. Morpholinos were diluted in sterile dH2O to a stock concentration of 100 μM and further diluted to 10 μM. One nL THR-MO or Control- MO morpholino was injected into the 1–2 cell stage embryo (1 hpf). Morpholino concentration was checked by standard PCR. Both Control- MO and THR-MO morpholinos were labeled with a fluorescent dye to allow examination of distribution of MO after injection with a fluorescent microscope. In subsequent analysis, only the embryos exhibiting widespread fluorescence by 4–24 hpf were kept. To test the role of increased THR-b mRNA in mediating toxicity of 6-OH-BDE-47 and T3, embryos were injected with ~3nL of corresponding mRNA in the 1–2 cell stage according to published methods64 (link) using a microinjection system consisting of a Nikon SMZ-1500 zoom stereomicroscope (Nikon Instruments Inc.., Lewisville, TX, USA) and a Narishige IM300 Microinjector (Narishge, Japan). THRβ mRNA was synthesized with SP6 polymerase and capped using a G(5’)ppp(5’)A RNA cap structure analog (New England Biolabs). Injection mRNA concentration was ~265 ng/uL. Phenol red was added to RNA samples before injection (0.05% final concentration) in order to track successful injections.
Dong W., Macaulay L.J., Kwok K.W., Hinton D.E., Ferguson P.L, & Stapleton H.M. (2014). The PBDE metabolite 6-OH-BDE 47 affects melanin pigmentation and THRβ MRNA expression in the eye of zebrafish embryos. Endocrine disruptors (Austin, Tex.), 2(1), e969072.
+ Open protocol
+ Expand
2

Investigating THRβ Modulation in Toxicity

Check if the same lab product or an alternative is used in the 5 most similar protocols
THRβ translation blocking (GCAGTATGTCAGAGCAAGCAGACAA, THR-MO) and 5-bp mismatch control (GgAGaATGTCtGAGCtAGCtGACAA) morpholinos (Control- MO) were designed with Gene Tools, LLC. Morpholinos were diluted in sterile dH2O to a stock concentration of 100 μM and further diluted to 10 μM. One nL THR-MO or Control- MO morpholino was injected into the 1–2 cell stage embryo (1 hpf). Morpholino concentration was checked by standard PCR. Both Control- MO and THR-MO morpholinos were labeled with a fluorescent dye to allow examination of distribution of MO after injection with a fluorescent microscope. In subsequent analysis, only the embryos exhibiting widespread fluorescence by 4–24 hpf were kept. To test the role of increased THR-b mRNA in mediating toxicity of 6-OH-BDE-47 and T3, embryos were injected with ~3nL of corresponding mRNA in the 1–2 cell stage according to published methods64 (link) using a microinjection system consisting of a Nikon SMZ-1500 zoom stereomicroscope (Nikon Instruments Inc.., Lewisville, TX, USA) and a Narishige IM300 Microinjector (Narishge, Japan). THRβ mRNA was synthesized with SP6 polymerase and capped using a G(5’)ppp(5’)A RNA cap structure analog (New England Biolabs). Injection mRNA concentration was ~265 ng/uL. Phenol red was added to RNA samples before injection (0.05% final concentration) in order to track successful injections.
Dong W., Macaulay L.J., Kwok K.W., Hinton D.E., Ferguson P.L, & Stapleton H.M. (2014). The PBDE metabolite 6-OH-BDE 47 affects melanin pigmentation and THRβ MRNA expression in the eye of zebrafish embryos. Endocrine disruptors (Austin, Tex.), 2(1), e969072.
+ Open protocol
+ Expand
3

Overexpression of Thyroid Hormone Receptor Beta

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
In our previous study, we showed 6-OH-BDE-47 to down-regulate expression of THRβ (Dong et al., 2014 ). THRβ mRNA was synthesized with SP6 polymerase and capped using a G(5’)ppp(5’)A RNA cap structure analog (New England Biolabs, Ipswich, MA). Embryos were injected with ~3 nL of THRβ (≈265 ng/μL) mRNA in the 1–2 cell stage according to published methods (Macaulay et al., 2015b (link)) using a microinjection system consisting of a Nikon SMZ-1500 stereomicroscope (Nikon Instruments Inc., Melville, NY, USA) and a Narishige IM300 Microinjector (Narishge, Japan). Embryos in control group were injected with ~3 nL of 0.9% NaCl solution. Phenol red (0.05%; Sigma Aldrich) was used to track injections according to Dong et al. (2014) .
Wang F., Fang M., Hinton D.E., Chernick M., Jia S., Zhang Y., Xie L., Dong W, & Dong W. (2018). Increased coiling frequency linked to apoptosis in the brain and altered thyroid signaling in zebrafish embryos (Danio rerio) exposed to the PBDE metabolite 6-OH-BDE-47. Chemosphere, 198, 342-350.
+ Open protocol
+ Expand
4

Measurement of Decapping Enzyme Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
Modified-capped short RNAs were prepared as described above. A-cap and G-cap short RNAs were co-transcriptionally synthesized using A-cap (G(5')ppp(5')A RNA Cap Structure Analog, New England Biolabs) or G-cap (GP3G (Unmethylated Cap Analog), JENA Bioscience) and purified by PAGE. For the DCP2 assay, 30 pmol of PAGE-purified RNAs were reacted with 50 U of mRNA Decapping Enzyme (New England Biolabs) in 1× MDE Buffer for 45 min at 37°C. For the DCPS assay, 30 pmol of PAGE-purified RNAs were reacted with 10 pmol of hDCPS (Recombinant human DCPS His Protein, Novusbio) in 10 mM Tris-OAc (pH 7.5), 100 mM KOAc, 2 mM Mg(OAc)2, and 2 mM DTT for 45 min at 37°C. Reactants were developed by denaturing PAGE. After staining with SYBR Green II (Lonza), the gel was visualized using Typhoon FLA 7000 (GE Healthcare). The decapping efficiency was calculated from the band intensity ratio of capped RNA and decapped RNA using Image Quant (GE Healthcare). Experiments were performed in triplicate, and the means and standard deviations were calculated. Statistical test was performed by Dunnett's test using KaleidaGraph (Synergy Software).
Ohno H., Akamine S., Mochizuki M., Hayashi K., Akichika S., Suzuki T, & Saito H. (2023). Versatile strategy using vaccinia virus-capping enzyme to synthesize functional 5′ cap-modified mRNAs. Nucleic Acids Research, 51(6), e34.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!