Protoscript m mulv taq rt pcr kit

Reverse transcription PCR was used to detect the expression of Bax, cyclin D1, CYP 1A1, and CYP 1A2 in response to treatment with ENLE at EC₅₀ for varying time intervals (350 μg/mL for 0, 48, and 72 h in MCF-7 and 175 μg/mL for 0, 24, and 48 h in HeLa cells) (Figures 5(a) and 5(b)). Total RNA extraction from untreated and ENLE-treated MCF-7 and HeLa cells was carried out as per the manufacturer's instructions (GenElute Mammalian Genomic Total RNA Kit, Sigma, USA) at various time intervals. Further, total RNA was subjected to first strand synthesis as per manufacturer's protocol (ProtoScript M-MuLV Taq RT-PCR Kit, New England Biolabs, USA) followed by PCR using gene-specific primers [23 , 25 (link)–28 (link)]. β-Actin was taken as an internal control. The PCR cycle was as follows: initial denaturation at 95°C for 5 min, followed by 35 amplification cycles (denaturation at 94°C for 30 s; annealing at 55°C for β-actin, CYP 1A1, and CYP 1A2, 56°C for Bax, and 54°C for cyclin D1; and extension at 72°C for 45 s), with final extension at 72°C for 7 min. Amplified products were visualized on a 2% agarose gel containing ethidium bromide.

Total RNA isolation was carried out as per the manufacturer's protocol using GenElute Mammalian Genomic Total RNA kit (Sigma, USA) from SFN treated and untreated HeLa cells at various time points (24, 48, and 72 h). Reverse transcription of RNA to synthesize cDNA was performed using the ProtoScriptM-MuLVTaq RT-PCR Kit (New England Bio Labs, USA) from 5 mg of total RNA (at 42°C for 60 min) followed by RT-PCR using gene-specific primers for β-actin, RARβ, CDH1, DAPK1, GSTP1, DNMTB, and HDAC1. The PCR cycle was as follows: initial denaturation at 95°C for 5 min, followed by 35 amplification cycles (denaturation at 94°C for 30 s, annealing Tm (β-actin: 56°C, RARβ: 56°C, CDH1: 55.5°C, DAPK1: 56°C, GSTP1: 55°C, DNMT3B: 56°C, and HDAC1: 56°C) for 30 s, and extension at 72°C for 45 s) with final extension at 72°C for 7 min. The primer sequences used were described previously [4 , 18 (link), 38 (link)–42 (link)]. Amplified products were visualized on a 2% agarose gel containing ethidium bromide.

The UAS-sir2 rescue construct was generated by PCR amplification of the sir2 coding region using primers designed to incorporate a KpnI restriction site in the forward primer (CGCGGGTACCCCAAATGGGTGCGAAGCTGACG) and an XbaI site in the reverse primer (CGCGTCTAGAGGCCCTCGGCTACGATTTCGCAG). The template for this reaction was cDNA generated from wild-type RNA using the ProtoScript M-MuLV Taq RT-PCR Kit (NEB). The gel-purified PCR product was digested with KpnI and XbaI and inserted into the multiple cloning site of pUAST-attB. This construct was integrated into each of three attP sites that are predicted to be silent (attP40, attP2, attP3) using standard methods (BestGene Inc.) [36 (link)]. We then combined this transgene with our sir2^2A-7-11 allele in order to study its effect in a transheterozygous sir2 mutant background. Only the rescue line inserted on the third chromosome at attP2, however, had sufficiently low background levels of sir2 expression to allow us to see changes in triglyceride levels and insulin signaling using tissue-specific GAL4 drivers, as shown in Figs 3C and S4B. Background expression from the UAS-sir2 transgene in all three lines is sufficient to rescue the hyperglycemia of sir2 mutants, preventing us from examining the tissue-specific regulation of this response in Fig 3.

Total RNA was extracted with RNeasy Mini Kit (250) from Qiagen according to the manufacturer’s instructions. The RNA concentration was measured with Nanodrop 8000 spectrophotometer (Thermo Scientific) and 1 μg of RNA was used to produce cDNA with the ProtoScript M-MuLV Taq RT-PCR kit using the oligo dT primers (New England BioLabs). Semi-quantitative real-time analysis (qPCR) was done with a 7500 qPCR System (Applied Biosystems, USA) using a GoTaq 2-step RT-qPCR System (Promega) to amplify the gene of interest following the instructions provided. Primer sequences are listed in Additional file 1: Table S1.

For more reliable results, results need to be validated on a larger number of biological replicates. Upon statistical analysis, we selected 7 lncRNAs (EGO-A, 7SL, RNCR3, MEG3, HOTAIR, ZFAS1, and JPX) for validation and to further investigate their differential expression on a cohort of 60 glioma samples and normal brain reference RNA (control). For the subsequent analyses of lncRNA expression, cDNA was generated with Protoscript M-MuLV Taq RT-PCR kit using random primers (New England Biolabs, UK) according to the manufacturer's instructions, except were otherwise indicated. Reverse transcription reactions were prepared in 10 μl master mix with 500 ng of total RNA. Expression analyses were validated using the TaqMan or SybrGreen-based qPCR technology, dependent on probes availability. All qPCR reactions were carried out on Rotor-Gene Q (Qiagen, Germany), and each sample was analysed in duplicate. Thermal conditions were applied as follows: initial denaturation at 95°C for 15 minutes and 40 cycles of denaturation at 95°C for 15 seconds and annealing at 60°C for 1 minute, and following amplification melting curves were acquired. The signal was collected at the endpoint of each cycle.