ChIP assays were implemented using Magna ChIP Assay kit (Millipore) following the manufacturer's instruction. In short, tissues were fixed with 1% formaldehyde and collected on ice with ChIP lysis buffer. Afterward, the DNA was sonicated and next, the supernatant was obtained and cultured with dynabeads protein G that had been conjugated with anti‐SP1, anti‐HDAC1 and anti‐acetylated histone antibodies. IgG was utilized as a negative control. ChIP‐derived DNA was quantified with qRT‐PCR with SYBR Green incorporation (Applied Biosystems) [21 (link)].
Sybr green incorporation
Manufactured by Thermo Fisher Scientific
Sourced in United States
SYBR-Green is a fluorescent dye that binds to double-stranded DNA. It is commonly used in quantitative real-time PCR (qPCR) assays to detect and quantify target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Magna chip assay kit, by Merck Group (2 mentions)
Ez chip chromatin immunoprecipitation kit, by Merck Group (2 mentions)
Magna chip chromatin immunoprecipitation kit, by Merck Group (2 mentions)
C myc, by Santa Cruz Biotechnology (1 mentions)
Ab59257, by Abcam (1 mentions)
Anti h3k4me2, by Merck Group (1 mentions)
Anti lsd1, by Merck Group (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Stepone system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Ddit3, by Qiagen (1 mentions)
Eif2ak4, by Qiagen (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
9 protocols using sybr green incorporation
1
ChIP-Seq Protocol for Histone Modifications
2
c-Myc Binding to CCAT1 Promoter via ChIP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) assays were performed according to the EZ ChIP Chromatin Immunoprecipitation Kit (Millipore, Bedford, MA, USA). Briefly, HeLa and CaSki cells were treated with formaldehyde and incubated for 10 min to generate DNA-protein cross-links. Cell lysates were then sonicated to generate chromatin fragments of 200–300 bp and immunoprecipitated with antibodies against c-Myc (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or IgG as control. The antibody-bound complex was precipitated by Protein A-Sepharose beads. The DNA fragments in the immunoprecipitated complex were released by reversing the cross-linking at 65°C for 5 hour and purified DNA was analyzed by qRT-PCR with SYBR-Green incorporation (Applied Biosystems, Foster City, CA, USA). The ΔCt was calculated as ΔCt (normalized ChIP) = [Ct (ChIP) – Ct (Input)]. The % input was shown as 2[−ΔCt(normalized ChIP)]. The primers specific for the CCAT1 promoter containing E-box and non-E-box were shown in Supplementary Table 2 .
3
ChIP Assay Using Magna ChIP Kit
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed using Magna ChIP Chromatin Immunoprecipitation Kit according to the manual (Millipore, Billerica, MA, USA). Cross-linked cells were sonicated to fragments (200–1,000 bp). Specific antibodies for SP1 (ab59257, Abcam) or FLAG were administered to precipitate DNA-protein complexes. The precipitated RNAs with proteins were quantified and detected by real-time qRT-PCR with SYBR-Green incorporation (Applied Biosystems, Foster City, CA, USA). Immunoglobulin G (IgG) acted as the negative control. The primer sequences for the promoter are presented in Table S1 .
4
Chromatin Immunoprecipitation Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed using the Chromatin Immunoprecipitation Assay Kit (Millipore Sigma, #17–295) according to the manufacturer’s standard protocol. DNA was quantified using qRT-PCR with SYBR green incorporation (Applied Biosystems). The antibodies used are listed in Supplementary Table 2 . The primers for gene expression are listed in Supplementary Table 1 .
5
ChIP Assay for LSD1 and H3K4me2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ChIP assay was performed using the Magna ChIP Chromatin Immunoprecipitation Kit (Millipore) using SiHa cells according to the manual protocol. In brief, crosslinked chromatin was sonicated into fragments (200–1,000 bp) and then immunoprecipitated with anti-LSD1 (Millipore) and anti-H3K4me2 (Millipore). Then, the precipitated DNA-protein complex was eluted and quantified using quantitative real-time RT-PCR with SYBR-Green incorporation (Applied Biosystems, Foster City, CA, USA). The primers are listed in Table S1 . Normal mouse IgG acted as a negative control.
6
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from BMDMs was extracted using the TRIzol reagent (Invitrogen) and cDNA was synthesized using the high capacity RNA-to-cDNA kit (Applied Biosystems), according to manufacturer’s protocols. qRT-PCR was performed using SYBR green incorporation (Applied Biosystems) and real-time PCR equipment (StepOne system) (Applied Biosystems). Expression of the genes of interest was normalized to the expression of the housekeeping gene Rps9 and expressed as “Fold change,” which was calculated by the 2−ΔΔCT method (26 (link)). The primers used were validated according Livak and Schmittgen (26 (link)) and listed in Table S1 in Supplementary Material.
7
ChIP Assay for miR-326 Promoter Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed using Magna ChIP Assay kit (Catalog # 17‐371, Millipore) according to the manufacturer's instruction. Briefly, tissues or cells were fixed using 1% formaldehyde and harvested on ice with ChIP lysis buffer. Subsequently, the DNA was sonicated and the supernatant was collected and incubated with dynabeads protein G that was conjugated with anti‐SP1, anti‐HDAC1 and anti‐acetylated histone antibodies. IgG was used as negative control. ChIP‐derived DNA was quantified using qRT‐PCR with SYBR Green incorporation (Applied Biosystems). The primers specific for the miR‐326 gene promoter and GAPDH are presented below:
| hsa‐miR‐326 promoter | Forward: 5′‐CCTGGGCTCACACAATCTTT‐3′; |
| Reverse: 5′‐TCACACCTGTAATCCCAGCA‐3′; | |
| GAPDH | Forward: 5′‐TACTAGCGGTTTTACGGGCG‐3′ |
| Reverse: 5′‐TCGAACAGGAGGAGCAGAGAGCGA‐3′ |
8
Chromatin Immunoprecipitation (ChIP) Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) assays were performed according to the EZ ChIP Chromatin Immunoprecipitation Kit (Millipore, Bedford, MA, USA). Briefly, crosslinked chromatin was sonicated into 200- to 1,000-bp fragments. Anti-c-Myc and anti-Max antibodies (Cell Signal Technology, USA) were used to precipitate DNA–protein complexes. Normal mouse immunoglobulin G (IgG) was used as a negative control. ChIP-derived DNA was quantified using qRT-PCR with SYBR-Green incorporation (Applied Biosystems, Foster City, CA, USA). The primers are listed in Additional file 1 .
9
Quantifying Stress Response Genes in T Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!