Pcdna3.1 directional topo expression kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, Belgium

The PcDNA3.1 Directional TOPO Expression Kit is a laboratory tool designed for the rapid and efficient cloning of DNA sequences into a mammalian expression vector. The kit provides a pre-linearized vector and a specialized enzyme that facilitates the directional insertion of PCR products into the vector, enabling the expression of the cloned DNA in mammalian cell lines.

Automatically generated - may contain errors

Lab products found in correlation

Phusion high fidelity pcr kit, by New England Biolabs (3 mentions) Pcdna3.1d v5 his topo vector, by Thermo Fisher Scientific (3 mentions) Quickcut xho 1 and hind 3, by Takara Bio (2 mentions) Protoscript 2 first strand cdna synthesis kit, by New England Biolabs (2 mentions) Qiaamp viral rna mini kit, by Qiagen (2 mentions) Escherichia coli top10f, by Thermo Fisher Scientific (2 mentions) P mir 711, by GeneCopoeia (2 mentions) Endofree plasmid giga kit, by Qiagen (2 mentions) Quickchange 2 xl site directed mutagenesis kit, by Agilent Technologies (1 mentions) Qiaquick pcr purification kit, by Qiagen (1 mentions) Anti v5 antibody, by Thermo Fisher Scientific (1 mentions) Eclipse ti e tirf imaging system, by Nikon (1 mentions) Quantem 512 sc camera, by Teledyne (1 mentions) Anti mouse alexa fluor 488, by Thermo Fisher Scientific (1 mentions) 4 6 diamidino 2 phenylindole (dapi), by Merck Group (1 mentions) Nis elements ar software, by Nikon (1 mentions) Lsrfortessa flow cytometer, by BD (1 mentions) Icyt sy3200, by Sony (1 mentions) Escherichia coli jm109 competent cells, by Takara Bio (1 mentions) High fidelity taq polymerase, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

PcDNA3.1 (2401 citations) Directional TOPO expression kit (5 citations) PcDNA3.1-TOPO (3 citations) PcDNA3.1 (þ) (2 citations)

23 protocols using pcdna3.1 directional topo expression kit

Generation of RBM20 and SRPK3 Reporters

Check if the same lab product or an alternative is used in the 5 most similar protocols

To create the RBM20_517–664-V5 reporter, the cDNA fragment coding amino acids 517–664 of mouse RBM20 was cloned into pcDNA3.1D/V5-His-TOPO in frame with C-terminal V5 and His6 tags using the pcDNA3.1 Directional TOPO Expression Kit (Thermo Fisher Scientific, K490001). The pcDNA5-FRT/TO-GFP-SRPK3 construct (DU 25699), expressing N-terminally GFP human SRPK3, was obtained from the Medical Research Council Protein Phosphorylation and Ubiquitylation Unit Reagents and Services (University of Dundee, Scotland).

Töpf A., Cox D., Zaharieva I.T., Di Leo V., Sarparanta J., Jonson P.H., Sealy I.M., Smolnikov A., White R.J., Vihola A., Savarese M., Merteroglu M., Wali N., Laricchia K.M., Venturini C., Vroling B., Stenton S.L., Cummings B.B., Harris E., Marini-Bettolo C., Diaz-Manera J., Henderson M., Barresi R., Duff J., England E.M., Patrick J., Al-Husayni S., Biancalana V., Beggs A.H., Bodi I., Bommireddipalli S., Bönnemann C.G., Cairns A., Chiew M.T., Claeys K.G., Cooper S.T., Davis M.R., Donkervoort S., Erasmus C.E., Fassad M.R., Genetti C.A., Grosmann C., Jungbluth H., Kamsteeg E.J., Lornage X., Löscher W.N., Malfatti E., Manzur A., Martí P., Mongini T.E., Muelas N., Nishikawa A., O’Donnell-Luria A., Ogonuki N., O’Grady G.L., O’Heir E., Paquay S., Phadke R., Pletcher B.A., Romero N.B., Schouten M., Shah S., Smuts I., Sznajer Y., Tasca G., Taylor R.W., Tuite A., Van den Bergh P., VanNoy G., Voermans N.C., Wanschitz J.V., Wraige E., Yoshimura K., Oates E.C., Nakagawa O., Nishino I., Laporte J., Vilchez J.J., MacArthur D.G., Sarkozy A., Cordell H.J., Udd B., Busch-Nentwich E.M., Muntoni F, & Straub V. (2024). Digenic inheritance involving a muscle-specific protein kinase and the giant titin protein causes a skeletal muscle myopathy. Nature Genetics, 56(3), 395-407.

+ Open protocol

+ Expand

Characterization of HIV-1 Env Variants

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Previously identified full-length env SGA amplicons were re-amplified with TOPO-TA cloning primers; patient-specific primers were designed to generate amplicons for the superinfecting variant (See Supplemental Methods). 8–10 SGA amplicons were generated from the seroconversion time point, and the sequences were aligned to establish a consensus sequence. The amplicon most similar to the consensus was purified with the Wizard SV Gel and PCR Clean Up system as previously described. Additionally, 8–10 full-length env SGA amplicons were also generated for the superinfection time point (greatest difference in PWD as compared to the seroconversion consensus sequence). Full-length envs were directionally subcloned into the pcDNA3.1 backbone using the pcDNA3.1 Directional TOPO Expression Kit (ThermoFisher Scientific; Waltham, MA) according to manufacturer’s protocol and transformed as previously described (Basu et al., 2012 (link); Kraft et al., 2012 (link)). Transformants were screened for the insert and miniprepped using the Pureyield Plasmid Miniprep System (ThermoFisher Scientific; Waltham, MA).

Woodson E., Basu D., Olszewski H., Gilmour J., Brill I., Kilembe W., Allen S, & Hunter E. (2019). Reduced frequency of HIV superinfection in a high-risk cohort in Zambia. Virology, 535, 11-19.

+ Open protocol

+ Expand

Cloning and Mutagenesis of Tgm2 in pcDNA3

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pcDNA3 and pcDNA3-Fyn-CA-V5 plasmids were constructed as previously published [16 (link)]. The IMAGE clone 3256943 (GenBank: BC016492) for mouse Tgm2 was obtained from imaGenes (Berlin, Germany) and PCR was performed with a pair of oligonucleotides (5′-CACCATGGACTACAAGGACGATGACGACAAG-ATGGCAGAGGAGCTG-3′ and 5′-TTAGGCCGGGCCGATGATAA-3′). The PCR product was separated on a 2% agarose gel and the specific single band was extracted using the QIAquick PCR purification kit (Qiagen, Venlo, The Netherlands). The purified PCR product was cloned into pcDNA3.1D/V5-His-TOPO using the pcDNA3.1 Directional TOPO Expression Kit (ThermoFisher). The pcDNA3.1-Flag-Tgm2-Y369 construct was obtained using the QuickChange 2-XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) with a pair of oligonucleotides (5′-GAAGAGCGAAGGGACATTCTGTTGTGGCCCA-3′ and 5′-TGGGCCACAACAGAATGTCCCTTCGCTCTTC-3′).

Uehara R., Yamada E., Okada S., Bastie C.C., Maeshima A., Ikeuchi H., Horiguchi K, & Yamada M. (2023). Fyn Phosphorylates Transglutaminase 2 (Tgm2) and Modulates Autophagy and p53 Expression in the Development of Diabetic Kidney Disease. Cells, 12(8), 1197.

+ Open protocol

+ Expand

Imaging of IL-17RC Protein Localization

Check if the same lab product or an alternative is used in the 5 most similar protocols

The TIRF assay was performed on the transfected HEK-293T cells as described in “Cell purification and culture.” V5 tag–IL-17RC WT and mutant (Q138*, R376*, and R378*) vectors were constructed at the N terminus by the pcDNA3.1 Directional TOPO Expression kit (Life Technologies). After being fixed in 3.7% paraformaldehyde, the cells coated glass coverslips and were incubated with anti-V5 antibody (Life Technologies) and Phalloidin (Life Technologies) for 3 h at room temperature. After being washed, the glass coverslips were incubated with anti–mouse Alexa Fluor 488 (Life Technologies) for 1 h at room temperature and then stained with DAPI (Sigma-Aldrich). Fluorescence data were acquired with the Eclipse Ti-E TIRF imaging system (Nikon). Images were recorded with the QuanTEM 512 SC camera (Roper Scientific) and acquired with NIS-Elements AR software (version 3.1; Nikon). Image sets were processed with ImageJ version 1.43 software (National Institutes of Health).

Ling Y., Cypowyj S., Aytekin C., Galicchio M., Camcioglu Y., Nepesov S., Ikinciogullari A., Dogu F., Belkadi A., Levy R., Migaud M., Boisson B., Bolze A., Itan Y., Goudin N., Cottineau J., Picard C., Abel L., Bustamante J., Casanova J.L, & Puel A. (2015). Inherited IL-17RC deficiency in patients with chronic mucocutaneous candidiasis. The Journal of Experimental Medicine, 212(5), 619-631.

+ Open protocol

+ Expand

Characterization of ErbB2 and ErbB3 Coexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols

A hemagglutinin peptide (HA) tag was introduced after the signal peptide but 5′ of the mature ErbB2 coding sequence and cloned into the pcDNA3.1 vector using the pcDNA3.1 Directional TOPO Expression Kit (Life Technologies, Grand Island, NY). CHO cells were sequentially transfected with the pcDNA3.1-^HAErbB2 and a pcDNA6-ErbB3-mCitrine construct and selected using G418 and blasticidin. Stably transfected cells were flow sorted on the iCyt SY3200 (Sony Biotechnologies, San Jose, CA) at the University of New Mexico Shared Flow Cytometry and High Throughput Screening Resource to obtain comparable expression levels of both receptors. The average receptor number for the sorted population was determined by flow using the LSR Fortessa Flow Cytometer (BD Biosciences, San Jose, CA) after labeling of live cells with Alexa 647–labeled anti-ErbB2 or anti-ErbB3 antibodies. Quantum MESF Alexa 647 microspheres (Bangs Laboratories, Fishers, IN) were used to quantify the fluorescence of the labeled cells. Receptor number was determined based on the average of two experiments performed on separate days.

McCabe Pryor M., Steinkamp M.P., Halasz A.M., Chen Y., Yang S., Smith M.S., Zahoransky-Kohalmi G., Swift M., Xu X.P., Hanien D., Volkmann N., Lidke D.S., Edwards J.S, & Wilson B.S. (2015). Orchestration of ErbB3 signaling through heterointeractions and homointeractions. Molecular Biology of the Cell, 26(22), 4109-4123.

+ Open protocol

+ Expand

Cloning and Expression of env Gene

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Individual products amplified from cDNA were determined via sequencing on an ABI 3770 Sequencer (Applied Biosciences, Beverly Hills, CA, USA), and the products were cloned into the vector using the pcDNA™ 3.1 Directional TOPO Expression kit (Invitrogen, Waltham, MA, USA). The env gene was then inserted with a cytomegalovirus promoter in the proper orientation for protein expression [22 (link)]. The cloned product was transformed into Escherichia coli JM109 competent cells (Takara, Beijing, China), and screened by culturing the cells on a selective medium containing ampicillin. Positive clones were determined based on the band pattern observed via electrophoresis following double digestion with QuickCut™ Xho I and Hind III (Takara, Beijing, China). If the electrophoresis result after cleavage showed two or more fragments, with one being 5.5 kb and the rest of the bands being at least 3 kb in total, the plasmid was assumed to be successfully ligated.

Tang W., Yuan Z., Wang Z., Ren L., Li D., Wang S., Hao Y., Li J., Shen X., Ruan Y., Shao Y, & Liu Y. (2023). Neutralization Sensitivity and Evolution of Virus in a Chronic HIV-1 Clade B Infected Patient with Neutralizing Activity against Membrane-Proximal External Region. Pathogens, 12(3), 497.

+ Open protocol

+ Expand

Env-Pseudovirus Production and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

The env gene of each T/F virus was amplified from the SGA-derived PCR amplicon of the 3′-half viral genome using the Taq High Fidelity polymerase (Invitrogen Life Technologies, Carlsbad, CA). The env amplicons were then gel-purified and ligated into the pcDNA3.1 vector using the pcDNA3.1 Directional TOPO Expression Kit (Invitrogen Life Technologies, Carlsbad, CA) as described previously41 (link). All env clones were confirmed by sequencing. To produce Env-pseudoviruses, 6 μg of each env clone was co-transfected with 10 μg of pNL43-ΔEnv-vpr⁺-luc⁺ into 293T cells using the FuGENE6 transfection reagent (Roche Diagnostics; Indianapolis, IN). The culture supernatants containing the pseudoviruses were harvested 72 hours post transfection, aliquoted and stored at −80 °C until use. Infectious titers (TCID₅₀) of pseudovirus stocks were determined on TZM-bl cells.

Song H., Hora B., Giorgi E.E., Kumar A., Cai F., Bhattacharya T., Perelson A.S, & Gao F. (2016). Transmission of Multiple HIV-1 Subtype C Transmitted/founder Viruses into the Same Recipients Was not Determined by Modest Phenotypic Differences. Scientific Reports, 6, 38130.

+ Open protocol

+ Expand

Cloning and Characterization of HIV-1 Envelope

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was isolated from the plasma samples using the QiaAmp viral RNA mini kit (Qiagen) following the manufacturer’s protocol followed by cDNA synthesis using the ProtoScript II first strand cDNA synthesis kit (New England Biolabs). The full length Env region (containing the open reading frames for the Env and Rev genes) was then amplified with subtype B or AE specific primers (Nie et al., 2010 (link)) and a nested PCR reaction using the Phusion High Fidelity PCR kit (New England Biolabs). The amplified Env region was cloned into the pCDNA3.1+ vector using the pCDNA3.1 directional TOPO® expression kit (Invitrogen) followed by full length sequencing analysis to verify the authenticity of the inserts. Contigs were established using DNA star software (DNASTAR Inc., Madison, WI) and Env Open reading frames for all constructs established. The GenBank accession numbers for the cloned Envs are listed in Table 2. Functionality of each Env was determined by generating pseudotyped HIV particles using respective Env constructs and pNLLuc R-/E- backbone as described below.

Joshi A., Cox E.K., Sedano M.J., Punke E.B., Lee R.T., Maurer-Stroh S., Kaur P., Tek N.O, & Garg H. (2017). HIV-1 Subtype CRF01_AE and B differ in utilization of low levels of CCR5, Maraviroc susceptibility and Potential N-glycosylation sites. Virology, 512, 222-233.

+ Open protocol

+ Expand

Murine Rpgrip1l Overexpression for Cilia

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full-length murine Rpgrip1lc DNA (fused to GFP) under the CMV promoter was purchased from Origene (Cat# MG218118; Rockville, MD). The overexpression Myc-tagged Ift46 and IFT20c DNA were also purchased from Origene (Cat # MR204208, RC201337). The mouse leptin receptor isoform b (Lepr-b) cDNA (Stratigopoulos et al., 2011 (link)) with 3 stop codons at the 3′end (introduced by PCR) was cloned downstream of the CMV promoter using the pcDNA3.1 Directional TOPO Expression Kit (Invitrogen). The human LEPR-b cDNA was amplified from a plasmid purchased by Sino Biological Inc. (NM_002303.3; Beijing, China) using primers5′-GCGCTAGCATGATTTGTCAAAAATTCTGTGTGG, 5′ATGGATCCCACAGTTAGGTCACACATCT, and cloned in CD520A-RFP at the NheI-BamHI restriction sites after digestion of the insert with NheI, BamHI and Mung Bean nucleases (NEB). CD520A-RFP was constructed by cloning RFP - amplified from pDsRed-Monomer-N1 (Clontech)using primers 5′-AATCGGATCCACCGGTCGCCACCAT and 5′-AATTCAGCGGCCGCTCTCTGGGAGCCGGAGTG - at the BamHI-NotI restriction sites of CD520A (System Biosciences, Mountain View, CAL).

Stratigopoulos G., Martin Carli J.F., O’Day D.R., Wang L., LeDuc C.A., Lanzano P., Chung W.K., Rosenbaum M., Egli D., Doherty D.A, & Leibel R.L. (2014). Hypomorphism for RPGRIP1L, a ciliary gene vicinal to the FTO locus, causes increased adiposity in mice. Cell metabolism, 19(5), 767-779.

+ Open protocol

+ Expand

HIV-1 env Gene Cloning for Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full length HIV-1 env genes were re-amplified from the first-round SGA products as previously described [41 (link)]. The PCR product was cloned into the pcDNA3.1D/V5-His-TOPO expression vector (Invitrogen) using the pcDNA 3.1 directional TOPO expression kit (Invitrogen).

Sturdevant C.B., Joseph S.B., Schnell G., Price R.W., Swanstrom R, & Spudich S. (2015). Compartmentalized Replication of R5 T Cell-Tropic HIV-1 in the Central Nervous System Early in the Course of Infection. PLoS Pathogens, 11(3), e1004720.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!