Transtaq dna polymerase high fidelity

Total RNA was isolated from PBMC, lung, kidney, gut, thymus, and spleen using Tri‐Reagent, as described in the manufacturer's instructions. Then, 2 μg of isolated RNA was reverse transcribed into complementary DNA (cDNA) with Hifair II 1st Strand cDNA Synthesis Kit (Yeasen). Then, PCR was performed with TransTaq DNA Polymerase High Fidelity (Yeasen). Sequences of primer pairs used in this study and the product sizes are listed in Supporting Information Table S1.

RNA was isolated from the PBMC, spleen and lung using Tri‐Reagent (Trans, Beijing) following the manufacturer's protocol. Reverse transcription RNA and cDNA Synthesis with Hifair® Ⅱ 1st Strand cDNA Synthesis Kit (gDNA digester plus) (Yeasen Biotech), PCR amplification with TransTaq DNA Polymerase High Fidelity (Yeasen Biotech), all the steps followed the manufacturer's protocol. Sequences of primers used and the predicted amplification sizes are as follows: for HLA‐DPA1‐V2 E2‐E3, 5′‐GCCTCAGTTCCTCATCAC‐3′ (forward) and 5′‐GAACGCTGGATCAAGGTAT‐3′ (reverse) 381 bp; for HLA‐DPA1‐V2 E4‐E6, 5′‐TTCCACAAGTTCCATTACCT‐3′ (forward) and 5′‐CCTAAGTCCTCTTCTGTTCA‐3′ (reverse) 303 bp; for HLA‐DPB1 E1‐E3, 5′‐CCACTCCAGAGAATTACCTT‐3′ (forward) and 5′‐GGAACCATCGGACTTGAAT‐3′ (reverse) 387 bp; for HLA‐DPB1 E3‐E6, 5′‐GTAATGGAGACTGGACCTTC‐3′ (forward) and 5′‐GACTTCAGAGCAACTTCTTG‐3′ (reverse) 386 bp; for HLA‐DOA E1‐E3, 5′‐CACCAAGGCTGACCACAT‐3′ (forward) and 5′‐CACGATGCAGATGAGGATG‐3′ (reverse) 331 bp; and for HLA‐DOA E3‐E5, 5′‐GTTCCGCAAGTTCCACTA‐3′ (forward) and 5′‐GCACTTAAAGGGCACTGA‐3′ (reverse) 336 bp.

RNA was isolated from the peripheral blood mononuclear cell (PBMC), spleen, kidney, gut, and lung using TRleasy Total RNA Extraction Reagent (Yeasen, Shanghai). Reverse transcription RNA and cDNA synthesis was performed using a Hifair II First Strand cDNA synthesis kit (gDNA digester plus) (Yeasen), RT‐PCR was amplified with TransTaq DNA Polymerase High Fidelity (Yeasen), and all the steps were followed according to the manufacturer's protocol. Primer sequences used and the predicted amplification sizes are as follows: HLA‐DRA, 5′‐TCCGCAAGTTCCACTATCTCC‐3′ (forward) and 5′‐CCATCACCTCCATGTGCCTTA‐3′ (reverse) 275 bp.