Taq buffer

Manufactured by New England Biolabs

Sourced in United States

Taq buffer is a solution used in polymerase chain reaction (PCR) to provide the optimal chemical environment for the Taq DNA polymerase enzyme to function effectively. It contains the necessary ions and pH that enable the enzyme to efficiently amplify DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Taq dna polymerase, by New England Biolabs (8 mentions) Taq polymerase, by New England Biolabs (5 mentions) Dntp mix, by New England Biolabs (4 mentions) Qubit 2.0 fluorometer, by Thermo Fisher Scientific (4 mentions) Qiaquick gel extraction kit, by Qiagen (4 mentions) Glycogen, by Thermo Fisher Scientific (3 mentions) Gelred staining, by Biotium (1 mentions) Abi 3730xl dna analyzer, by Thermo Fisher Scientific (1 mentions) Wizard genomic dna purification kit, by Promega (1 mentions) Mastercycler gradient, by Eppendorf (1 mentions) Bovine serum albumin (bsa), by New England Biolabs (1 mentions) Mastercycler gradient thermal cycler, by Eppendorf (1 mentions) Prism 3100 genetic analyzer, by Thermo Fisher Scientific (1 mentions) High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions)

17 protocols using taq buffer

Random Mutagenesis via Error-Prone PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Random mutagenesis was carried out via error-prone PCR. Reaction conditions were optimized to generate 1–2 codon mutations per plasmid. Reactions were setup by adding the following to a PCR tube: 5 μL 10x Taq buffer (New England Biolabs), 1 μL 10 mM dNTP mix, 1 μL 10 μM 22b-intF, 1 μL 10 μM 22b-intR, 1 μL ~100 ng/μL parent plasmid, 5.5 μL 50 mM MgCl₂, 2.5 or 5 μL 1 mM MnCl₂, 1 μL DMSO, 0.5 μL Taq polymerase (New England Biolabs) and total volume was made up to 50 μL with H₂O.
The PCR product was purified using a preparative agarose gel. Purified DNA fragment was inserted into a pET-22b(+) vector by the Gibson Assembly method.^{41 (link)} BL21 (DE3) E. coli cells were subsequently transformed with the resulting cyclized DNA product via electroporation. After 45 min of recovery in Luria-Burtani (LB) media containing 0.4% glucose at 37 °C, cells were plated onto LB plates with 100 μg/mL Ampicillin (Amp) and incubated overnight. Single colonies were used to inoculate 5 mL LB + 100 μg/mL amp (LB_amp), which were grown overnight at 37 °C, 200 rpm. Colonies were sequenced and there were 1 – 2 coding mutations for both the concentrations of MnCl2.

Ellis J.M., Campbell M.E., Kumar P., Geunes E.P., Bingman C.A, & Buller A.R. (2022). Biocatalytic synthesis of non-standard amino acids by a decarboxylative aldol reaction. Nature catalysis, 5(2), 136-143.

+ Open protocol

+ Expand

Random Mutagenesis via Error-Prone PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Apcdd1 Mutant Mouse Generation and Genotyping

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We employed a previously described Apcdd1 mutant strain in which loxP sites had been engineered to flank exons 2 and 3 (Figure S1) (Turakainen et al., 2009 (link)). We crossed Apcdd1Ex2,3^flox/flox mice to a strain bearing the Cre recombinase under a heat shock promoter, which is ubiquitously expressed (Dietrich et al., 2000 (link)), to yield Apcdd1Δex2,3^−/− mutants (Figure S2A). Apcdd1Δex2,3^−/− (hereafter designated Apcdd1⁻^/⁻) mutants are viable and fertile and do not exhibit any overt embryonic developmental defects. PCR primers for the Apcdd1 wild-type allele are forward (5′-GAGTGTCCCCGACTCCGACTCT) and reverse (5′-ATGTGTTGAGTTATTCCCGGAAG). PCR primers for the Apcdd1 mutant allele are forward (5′-GCCCATCTGGGATAGTACATGTG) and reverse (5′-CCTGGACT GAGGGCCATAGGTAAGAGG). Amplification was performed using Taq DNA polymerase with standard Taq buffer (New England Biolabs). PCR thermal cycler was programmed for 3 min at 94°C for initial denaturation, followed by 30 cycles of 30 s at 94°C for denaturation, 30 s at 60°C for annealing, 90 s at 72°C for extension and 10 min at 72°C for final extension. The fragment sizes for Apcdd1 wild-type and mutant alleles are 1 kb and 1.8 kb, respectively (Figure S2B). Both male and female wild-type or Apcdd1^−/− mice were used for experiments.

Mazzoni J., Smith J.R., Shahriar S., Cutforth T., Ceja B, & Agalliu D. (2017). The Wnt Inhibitor Apcdd1 Coordinates Vascular Remodeling and Barrier Maturation of Retinal Blood Vessels. Neuron, 96(5), 1055-1069.e6.

+ Open protocol

+ Expand

Validating Transcriptome Assembly via PCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To validate the precision and quality of transcriptome assembly, PCR amplification of 25 randomly selected genes with gene-specific primers was carried out using pooled cDNA (from five stages of seed development) as a template. The gene-specific primer for all the genes was designed based on the transcriptome sequence using Primer3Plus software^{60 (link)}. The primer sequences are provided in Supplementary Table S5. PCR was carried out using Taq DNA polymerase with standard Taq buffer (New England Biolabs, MA, USA). The PCR conditions that are used are as follows: Initial denaturation of 95 °C for 1 min followed by 35 cycles of denaturation at 95 °C for 20 sec, annealing temperature for 30 sec, extension of 68 °C for 2 min and final extension at 68 °C for 5 min. PCR products were analysed on a 0.8% agarose gel. Further, PCR amplified products of all the genes were sequenced using Sangers platform and compared with the De novo assembled transcripts to confirm their sequence identities.

Sreedhar R.V., Prasad P., Reddy L.P., Rajasekharan R, & Srinivasan M. (2017). Unravelling a stearidonic acid-rich triacylglycerol biosynthetic pathway in the developing seeds of Buglossoides arvensis: A transcriptomic landscape. Scientific Reports, 7, 10473.

+ Open protocol

+ Expand

Conventional PCR Optimization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Conventional PCR reactions were performed using Taq polymerase (NEB) in Taq buffer (NEB), dNTPs (0.2 mM each), as well as forward and reverse primers (0.1 µM each, IDT). The following three step cycle was used: 94°C for 45 sec, 52°C for 1 min 25 sec, and 72°C for 1 min 55 sec. A pilot PCR was done to determine the optimal number of cycles.

Kong K.Y., Jeng S.C., Rayyan B, & Unrau P.J. (2021). RNA Peach and Mango: orthogonal two-color fluorogenic aptamers distinguish nearly identical ligands. RNA, 27(5), 604-615.

+ Open protocol

+ Expand

16S rDNA Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from an overnight culture of each strain using the wizard genomic DNA purification kit (Promega, Madison, WI, United States) as described by Fernandez et al. (2015) (link). The 16S ribosomal DNA was amplified by PCR (Eppendorf Mastercycler gradient, Hamburg, Germany) with 27f 5′-AGAGTTTGATCMTGGCTCAG-3′ (Gürtler and Stanisich, 1996 (link)) and 1390r 5′-GACGGGCGGTGTGTACAA-3′ (Zheng et al., 1996 (link)) primers (Invitrogen, Carlsbad, CA, United States). The reaction volume was 50 μL, composed of 1 × Taq buffer (New England Biolabs, Beverly, MA, United States), 0.25 U of Taq DNA polymerase (New England Biolabs), 200 nM of each primer, 200 μM of a dNTP mixture (A, T, C, and G, Invitrogen), and 20 ng of bacterial DNA. The thermal cycle program consisted of an initial cycle of 94°C for 5 min for denaturation and polymerase activation, 35 cycles of 94°C for 45 s, 54°C for 45 s, and 68°C for 60 s, and a final extension step of 5 min at 68°C. PCR products were then subjected to gel electrophoresis (100 V, 1 h) on a 1% agarose gel in Tris-acetate-EDTA 1 × buffer (Ambion, Life Technologies Inc., Burlington, ON, Canada) and visualized by gelRed staining (Biotium, Inc., Hayward, CA, United States). Finally, pure PCR products were sequenced using an ABI 3730XL DNA analyzer (Applied Biosystems, Streetsville, ON, Canada).

Vimont A., Fernandez B., Hammami R., Ababsa A., Daba H, & Fliss I. (2017). Bacteriocin-Producing Enterococcus faecium LCW 44: A High Potential Probiotic Candidate from Raw Camel Milk. Frontiers in Microbiology, 8, 865.

+ Open protocol

+ Expand

Amplification and Genotyping of Symbiodinium fitti Microsatellites

Check if the same lab product or an alternative is used in the 5 most similar protocols

Symbiodinium “fitti” DNA was amplified with primers given by Pinzón, Devlin‐Durante, Weber, Baums, and LaJeunesse (2011) (n = 10 loci). Three additional loci for S. “fitti” were developed de novo (Table S1). Alleles were fluorescently visualized and sized with internal standards on a PRISM 3100 Genetic Analyzer (Applied Biosystems). Briefly, 25–50 ng of template DNA was added to polymerase chain reactions (PCRs) containing 1 × Standard Taq Buffer (New England Biolabs), 2.5 mm MgCl (New England Biolabs), 0.5 mg/ml bovine serum albumin (New England Biolabs) and 0.75 U of Taq (0.325 U for primers 31, 32 and 41; New England Biolabs). Each primer was added at 200 nm to reactions involving loci A3Sym_01, 18, 27 and 28, whereas a primer concentration of 93 nm was added to reactions for primers 31, 32 and 41. Concentrations of 50 nm of the tailed forward primer (see Table S1), 150 nm of the reverse primer and 75 nm of the dye‐labelled T‐oligonucleotide were used for amplifying loci A3Sym_01, 02, 03, 07, 08, 09 and 48. All loci were amplified using the following thermal cycle profile: 94°C for 2 min (one cycle); 94°C for 15 s, primer‐specific annealing temperature (Table S1) for 15 s and 72°C for 30 s (31 cycles); and 72°C for 30 min on a Mastercycler gradient thermal cycler (Eppendorf). Table S2 provides details of microsatellite genotype allele calls.

Durante M.K., Baums I.B., Williams D.E., Vohsen S, & Kemp D.W. (2019). What drives phenotypic divergence among coral clonemates of Acropora palmata?. Molecular Ecology, 28(13), 3208-3224.

+ Open protocol

+ Expand

Taq In Vitro Transcription Plasmid Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA material for Taq in vitro transcription first underwent plasmid cloning as previously described to replace introduce the T7 A1 E. coli RNA polymerase promoter sequence (ccgaattcaaaaagagtattgacttaaagtctaacctataggatacttacagcc). The double stranded DNA templates were then synthesized through a 200 μL PCR reaction containing 10x Taq Buffer (NEB, #B9014S), 250 μM dNTP Mix (NEB, #N0447L), 125 nM primer C (Supplementary Table S2), 125 nM primer B (Supplementary Table S2), 1 μL DNA plasmid, and 1 μL Taq DNA Polymerase (NEB, #M0273X). Reactions underwent a standard thermal-cycle program with 25 cycles of amplifications with an annealing temperature of 53 °C. DNA was purified through an ethanol precipitation with 20 μL 1M NaCl, 1 μL glycogen (Thermo, #AM9515), and 600 μL EtOH. The precipitated pellet was air dried, dissolved in H₂O, and run on a 2% agarose gel. The template band was extracted using the QIAquick Gel Extraction Kit (Qiagen, #28706X4) and re-purified through ethanol precipitation. DNA concentrations were measured on a Qubit 2.0 Fluorometer (Life Technologies, #Q33216).

Hertz L.M., White E.N., Kuznedelov K., Cheng L., Yu A.M., Kakkaramadam R., Severinov K., Chen A, & Lucks J.B. (2023). The Effect of Pseudoknot Base Pairing on Cotranscriptional Structural Switching of the Fluoride Riboswitch. bioRxiv.

+ Open protocol

+ Expand

Multilineage Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total mRNA was isolated from the pluripotent, progenitor, and differentiated cells with Trizol (Invitrogen Life Technologies, 250 μl per dish). 50 μl of Choloroform was added to each sample. The samples were centrifuged and the upper aqueous phase was collected and RNA was precipitated with isopropyl alcohol. The samples were centrifuged and washed two times with 75% ethanol. The RNA pellet was dried and resuspended in DEPC-treated water. cDNA was created from the RNA samples using the High Capacity RNA-to-cDNA kit™ (Applied Biosystems Life technologies, Grand Island, NY). PCR reactions consisted of a mixture of Taq buffer (New England Biolabs, Ipswich, MA), forward and reverser primers (listed below) dNTP (10mM), Taq polymerase, water and cDNA. Electrophoresis was used to run DNA samples on a 1.8% agarose gel. Band intensity was quantified using ImageJ software (NIH, Bethesda, MD).
Primer pairs:
18S: GACTCAACACGGGAAACCTC (forward), ATGCCAGAGTCTCGTTCGTT (reverse)
Bcl-2: GCTGTGAGGGAGCAAGAATC (forward), GGTCAAGAGGGAGTGTTGGA (reverse)
SDF-1α: GCTCTGCATCAGTGACGGTA (forward), CCAGGTACTCTTGGATCCAC (reverse)

Chau M., Deveau T.C., Song M., Wei Z.Z., Gu X., Yu S.P, & Wei L. (2017). Transplantation of iPS cell-derived neural progenitors overexpressing SDF-1α increases regeneration and functional recovery after ischemic stroke. Oncotarget, 8(57), 97537-97553.

+ Open protocol

+ Expand

Multiplex PCR for Construct Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Multiplex PCR was employed to confirm correct integration of the safe haven-targeting constructs. 12 μL of sterile water and a small amount of Cryptococcus cells on the end of a pipette tip were added to a PCR tube for each reaction and incubated for 10 minutes at 94°C. 2.5 μL of each of the 10 mM primer stocks (UQ1768, UQ2962, UQ2963 and UQ3348), 2.5 μL Taq buffer, 0.5 μL 10 mM dNTPs and 0.1 μL of Taq polymerase (New England Biolabs, USA) were then added and the reaction returned to the PCR machine. The cycling parameters were 35 cycles of 94°C for 20 seconds, 55°C for 20 seconds and 72°C for 90 seconds. Products were visualized using electrophoresis with a 1% TAE agarose gel.

Arras S.D., Chitty J.L., Blake K.L., Schulz B.L, & Fraser J.A. (2015). A Genomic Safe Haven for Mutant Complementation in Cryptococcus neoformans. PLoS ONE, 10(4), e0122916.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!