Quantitect primer assay primers

Quantitative Real-time PCR (qRT-PCR) was used to measure mRNA expression levels of αSMA (ACT2A), collagen type I (COL1A1), collagen type III (COL3A1), SMAD2 and SMAD3, as a validation of the array data. All primers were validated (primer efficiency confirmed to be between 90–105%), sequenced and have previously been published^{21 (link),22 (link),61 (link)}. PCR products were run on a 1.5% agarose gel to confirm product size and each product was sequenced to confirm specificity of the primers. Gene expression was quantified using Brilliant SYBR Green QRT-PCR 1-Step master mix (Strategene, the Netherlands) in the Strategene MX3000p system. All expression data were normalized to β-actin using Quantitect primer assay primers (Qiagen, Germany), HS_ACTB_1_SG and corrected using the reference dye ROX. For each experiment >50% of the samples used were also used for the RT² profiler human fibrosis PCR array.

HLMF RNA was isolated using the RNeasy Plus Kit (Qiagen, West Sussex, U.K.) according to the manufacturer’s instructions. Primers were designed for αSMA (ACT2A): forward, 5′-TTCAATGTCCCAGCCATGTA-3′ and reverse, 5′-GAAGGAATAGCCACGCTCAG, product size 222 bp from the National Center for Biotechnology Information Reference sequence NM_001141945.1; collagen type I (COL1A1) forward, 5′-TTCTGCAACATGGAGACTGG and reverse, 5′-CGCCATACTCGAACTGGAATC; and collagen type IV (COL4A1), forward, 5′-GGACTACCTGGAACAAAAGGG and reverse, 5′-GCCAAGTATCTCACCTGGATCA, product size 240 bp from reference sequence NM_001845.4; β-actin primers were analyzed using gene-specific Quantitect Primer Assay primers (Qiagen), HS_ACTB_1_SG. All expression data were normalized to β-actin and corrected using the reference dye ROX. Gene expression was quantified by real-time PCR using the Brilliant SYBR Green QRT-PCR 1-Step Master Mix (Stratagene). PCR products were run on a 1.5% agarose gel to confirm the product amplified was the correct size, and each of the products was sequenced to confirm the specificity of the primers.

HLMF RNA was isolated using the RNeasy Plus Kit (Qiagen, West Sussex, UK) according to the manufacturer’s instructions. Primers were designed for ACT2A, forward TTCAATGTCCCAGCCATGTA and reverse GAAGGAATAGCCACGCTCAG, product size 222 bp from NCB1 Reference sequence NM_001141945.1 and COL1A1, forward TTCTGCAACATGGAGACTGG and reverse CGCCATACTCGAACTGGAATC, product size 151 bp from reference sequence NM_000088.3. K_Ca3.1 and β-actin primers were analysed using gene-specific Quantitect Primer Assay primers (Qiagen, Hilden, Germany), Hs_KCNN4_1_SG and HS_ACTB_1_SG. All experiments were performed in duplicate. All expression data was normalized to β-actin and corrected using the reference dye ROX. Gene expression was quantified by real-time PCR using the Brilliant SYBR Green QRT-PCR 1-Step Master Mix (Stratagene, Breda, The Netherlands). PCR products were run on a 1.5% agarose gel to confirm the product amplified was the correct size, and they were sequenced to confirm the specificity of the primers. Prior to qRT-PCR, myofibroblasts were grown to confluence, serum starved for 24 h and then stimulated with TGFβ1 (10 ng/ml) in the presence of 0.1% DMSO control, TRAM-34 (200 nM) or ICA-17043 (100 nM).