Trizol reagent was used to extract total RNA (Life Technologies, Grand Island, NY, USA) according to the manufacturer’s instructions. qRT-PCR was performed in NanoQ (OPTIZEN, Daejeon, Korea) with reagents obtained from TaKaRa Biotechnology Co., Ltd. (Dalian, China). DNA (cDNA) was synthesized as per manufacturer protocol SuperScript® VILO™ cDNA synthesis kit (Life Technologies). PCR cycles were performed with specific primers using a two-step reaction and run using the Eco TM Real-Time PCR system (Illumina, CA, USA). The master mix consisted of 2 x Real-Time PCR Master mix containing SYBR Green I (BIOFACT, Korea) with 100 ng of template DNA and 10 nM of each primer in a final volume of 20 μL. The qPCR cycle was run at 95 °C for 15 min, with concurrent denaturation at 95 °C, annealing and extension at 60 °C for 34 s for 40 cycles. Primers for PRP4, ARRB1, CaSR, and GAPDH were the same as those described for RT-PCR.
Real time pcr master mix
Manufactured by Biofact
Sourced in United States
The 2X Real-Time PCR Master Mix is a ready-to-use solution for real-time PCR amplification. It contains all the necessary components, including DNA polymerase, dNTPs, and optimized buffer, to perform real-time PCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Sybr green 1, by Biofact (3 mentions)
Cfx connect real time system, by Bio-Rad (3 mentions)
Ecotm real time pcr system, by Illumina (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Rneasy plant mini kit, by Qiagen (2 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
Reverse transcriptase, by Takara Bio (1 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Riboex reagent, by Thermo Fisher Scientific (1 mentions)
Ariamx 1, by Agilent Technologies (1 mentions)
Lightcycler 96 system, by Roche (1 mentions)
Quantstudio 1 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Accupower rt premix, by Bioneer (1 mentions)
Ultrospec 8000, by GE Healthcare (1 mentions)
Accuprep universal rna extraction kit, by Bioneer (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
Topscript rt drymix dt18, by Enzynomics (1 mentions)
20 protocols using real time pcr master mix
1
RNA Isolation and qRT-PCR Analysis Protocol
2
Comprehensive RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tissues and cultured cells was isolated using RiboEx reagent (Invitrogen, USA) following the manufacturer's protocol. The integrity and purity of the extracted total RNA were evaluated using agarose gel electrophoresis and NanoDrop (Thermo Scientific, USA). The first-strand cDNA was synthesized from total RNA (1 g) using reverse transcriptase (Takara, China). For miRNA detection, polyA tail was added to the 3 ends of RNAs before cDNA synthesis. RT-qPCR was performed using the Step One™ Real-Time PCR System (Applied Biosystems, USA) and Real-Time PCR Master Mix (Biofact, USA). The expression levels and relative expression levels were calculated using the 2 -Ct and 2 -Ct methods, respectively. The gene-specific primers are provided in Table 1. The mRNAs and miRNAs expression levels were normalized against GAPDH or U48 small RNA as the internal controls, respectively.
3
Real-Time PCR Quantification of Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-Time PCR was performed using the BioFACT™ 2X Real-Time PCR Master Mix and gene-specific primers. The total reaction volume was set in a 10 μl. The reaction was performed in three steps as follows: Step 1: 95 °C in 13 min for holding stage or initial heat. Step 2: 45 cycles for denaturation at 95 °C in 10 s, primer annealing at 60 °C in 30 s, and extension at 72 °C in 20 s. Step 3: at the end of each run melting curves were obtained. The GAPDH gene was used for data normalization. The expression of target genes was calculated using the 2-ΔΔCt method. NCBI Primer-3 online website, (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) was used to design primers. In Table 1 qPCR primer sequences are provided.
qPCR primer sequences.
| Target gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| B4GALT1-AS1 | GCATCAGAGAGAATATGGAAGG | GGCTTAATAGTTGGTTCAGTG |
| GAPDH | AAGGTGAAGGTCGGAGTCAAC | GGGGTCATTGATGGCAACAA |
4
Transcriptional Analysis of Heavy Metal Stress Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following the manufacturer’s instructions, total RNA from the leaves was extracted using the TRIzol reagent. Then, complementary DNA (cDNA) was synthesized from RNA by using a BioFACT RT kit. Gene expression analysis was performed using the synthesized cDNA as a template. Using the Eco™ real-time PCR system, a 20 µL reaction mixture containing 2X Real-Time PCR Master Mix [(including SYBR® Green I) BIOFACT, Korea] and 10 nM of each primer was processed (Illumina, USA). The negative control was a no-template control (NTC) using nuclease-free water instead of the cDNA template. Initial denaturation took place at 95 °C for 15 min, then there were 40 cycles of 95 °C for 10 s and 60 °C for 30 s. The internal reference gene was Actin [18 (link)]. The expression of heavy-metals-stress-related genes, including OsPC1, OsPC2, OsMTP1, OsMTP5, OsMT-1-1a, and OsMT-1-1b, was analyzed. Supplementary Table S1 lists the genes and related primers along with their names and sequences.
5
Quantitative PCR for Relative Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qPCR, the cDNA was diluted tenfold. The qPCR was performed using 2X Real-Time PCR Master Mix (Biofact, Daejeon, Korea) in a final volume of 20 μL and CFX Connect Real-Time System (BIO-RAD, Hercules, CA, USA) under the following conditions: 95 °C for 15 min followed by 40 cycles of 95 °C for 20 s, 55 °C for 40 s, and 72 °C for 20 s. Relative gene expressions were determined with normalization against the expression of the pepper CaActin7 gene. The primers used for the qPCR are listed in Supplementary Table S2 , and are designed based on a reference gene set using the Primer 3 plus server (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi ). The relative gene expression was calculated using the 2-ΔΔCt method51 (link).
6
Quantifying Cytokine and Stress Response mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA expression levels determined by Real-Time PCR (Agilent Co., Santa Clara, CA., USA) using 2X Real-Time PCR Master Mix (Including SYBR Green I, Low ROX, Bio-Fact Co.). Data analysis was performed using the Agilent Aria MX 1.0 program. Primer sequences for rat IL6, TNFα, IL10, BiP and β-actin were as follows; (IL6) fw: TCC TAC CCC AAC TTC CAA TGC TC, rv: TTG GAT GGT CTT GGT CCT TAG CC, (TNFα) fw: GTC GTA GCA AAC CAC CAA G, rv: AGA GAA CCT GGG AGT AGA TAA G, (IL10) fw: ATT GAA CCA CCC GGC ATC TA, rv: CAA CGA GGT TTT CCA AGG AG, and (BiP) fw: AGA AAC TCC GGC GTG AGG TAG A, rv: TTT CTG GAC AGG TTT CAT GGT AG, (β-actin) fw: GGC ACC ACA CTT TCT ACA AT, rv: AGG TCT CAA ACA TGA TCT GG
7
Cytokine and Ubiquitin-Proteasomal Markers in C2C12 Myotubes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C2C12 myoblasts were incubated in a 6-well plate (3×106cells/well), and differentiation was induced. To analyze the expression of
proinflammatory cytokines (TNF-α and IL-6), C2C12 myoblasts were treated
with 0.25 μg/mL of LPS. C2C12 myotubes wer analyzed for expression of two
ubiquitin-proteasomal markers [Atrogin-1 and muscle RING finger protein-1
(MuRF-1)]. Following differentiation for 5 d, C2C12 myotubes were pretreated
with horse meat hydrolysates for 1 h, and then cells were treated with 100
μM DEX for 24 h to mimic the conditions of muscle atrophy. Total RNA was
extracted using a RNeasy Mini kit (Qiagen, Hilden, Germany) according to the
manufacturer’s instructions. Pre-Mix (dT18 Plus; BioFact, Daejeon, Korea)
was used to synthesize cDNA. Each cDNA was amplified on a LightCycler 96 System
(Roche Diagnostics, Basel, Switzerland) using 2X Real-Time PCR Master Mix
(BioFact). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was
used as a reference gene to normalize mRNA levels. The primers used for
amplification and corresponding annealing temperature values are provided in
Table 1 .
proinflammatory cytokines (TNF-α and IL-6), C2C12 myoblasts were treated
with 0.25 μg/mL of LPS. C2C12 myotubes wer analyzed for expression of two
ubiquitin-proteasomal markers [Atrogin-1 and muscle RING finger protein-1
(MuRF-1)]. Following differentiation for 5 d, C2C12 myotubes were pretreated
with horse meat hydrolysates for 1 h, and then cells were treated with 100
μM DEX for 24 h to mimic the conditions of muscle atrophy. Total RNA was
extracted using a RNeasy Mini kit (Qiagen, Hilden, Germany) according to the
manufacturer’s instructions. Pre-Mix (dT18 Plus; BioFact, Daejeon, Korea)
was used to synthesize cDNA. Each cDNA was amplified on a LightCycler 96 System
(Roche Diagnostics, Basel, Switzerland) using 2X Real-Time PCR Master Mix
(BioFact). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was
used as a reference gene to normalize mRNA levels. The primers used for
amplification and corresponding annealing temperature values are provided in
8
RNA Extraction and qPCR Analysis of Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from 1 × 106 BMDMs, RAW264.7 cells, and TAMs using the AccuPrep Universal RNA Extraction Kit according to the manufacturer's instructions (K-3140, Bioneer Corporation). The RNA concentration was determined by Ultrospec 8000 (GE Healthcare). Total RNA (1 μg) was reverse transcribed using AccuPower RT premix (Bioneer Corporation). For qPCR, RNA expression was analyzed on the QuantStudio 1 Real-Time PCR System (Thermo Fisher Scientific) using SFCgreen included in the 2X Real-time PCR Master Mix (DQ362-40h, BioFACT) at a concentration of 0.4 μL cDNA/sample. The primers for each of the genes are listed in Supplementary Table S1 . Quantitative gene expression data were normalized to the expression levels of β-actin.
9
Evaluating Gene Expression in Tumor Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate gene expression in tumor models, total RNA was rst isolated from tumor masses using BRIzol reagent (Faragene Co., Tabriz, Iran) according to the supplied protocol. The quality and concentration of extracted RNA were evaluated using the NanoDrop spectrophotometer (ThermoFisher Scienti c Life Sciences, USA). Then, total RNA was reverse transcribed into complementary DNA (cDNA) with AddScript Enzyme solution (AddScript cDNA Synthesis Kit, Korea) in the presence of random hexamer following manufacturer's instructions. Synthesized cDNA was then subjected to real-time PCR using 2X Real-Time PCR Master Mix (BioFACT, Korea) in the StepOnePlus Real-Time PCR System (Applied Biosystems, USA). To normalize Bax, Bcl-2, MMP9, VEGFA and COX-2 expression, β2 microglobulin was used as internal control. Changes in mRNA expression were shown as fold change. Primers used in this study were presented in Table 1.
10
Quantification of IbFAD8 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen ground tissues of sweetpotato plants using the TRIzol Reagent (Invitrogen, MA, United States), according to the manufacturer’s instructions. Then, cDNA was synthesized from the isolated RNA using TOPscriptTM RT DryMIX (dT18) (Enzynomics, Daejeon, South Korea). To quantify gene expression levels, qRT-PCR was conducted on a Bio-Rad CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, United States) using 2X Real-Time PCR Master Mix and EvaGreenTM dye (BioFACT, Daejeon, South Korea). The conditions for the qRT-PCR was as follows: initial denaturation for 15 min at 95°C, followed by 45 cycles of 95°C for 20 s, 58°C for 40 s, and 72°C for 20 s. Relative gene expression were calculated using the comparative delta-delta Ct method, and the Ubiquitin gene was used as an internal control for the normalization of IbFAD8 expression levels. The transcript levels were expressed as relative values, which the lowest expression was valued as 1. The sequences of primers used for qRT-PCR are listed in Supplementary Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!