Log In Sign up
The largest database of trusted experimental protocols

Picopure kit

Manufactured by Arcturus
Visit Supplier

The PicoPure kit is a lab equipment product designed for precise liquid handling. It features a compact, handheld pipette with adjustable volume settings to enable accurate and reproducible sample transfers.

Automatically generated - may contain errors

Lab products found in correlation

Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions) Picopure rna isolation kit, by Arcturus (1 mentions) Mouse genome 430 2.0 array, by Thermo Fisher Scientific (1 mentions) Encore biotin module, by Tecan (1 mentions) Dnase 1 treatment, by Qiagen (1 mentions) Bioanalyzer, by Agilent Technologies (1 mentions) Superscript 3 kit, by Thermo Fisher Scientific (1 mentions) Qiaquick pcr purification kit, by Qiagen (1 mentions) Nextseq 550, by Illumina (1 mentions) Rlt buffer, by Qiagen (1 mentions) β mercaptoethanol, by Merck Group (1 mentions) Hiseq 2500 v4 chemistry, by Illumina (1 mentions) Hiseq 4000 platform, by Illumina (1 mentions) Smart seq v4 ultra low input rna kit, by Takara Bio (1 mentions) Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Pixcell 2 lcm system, by Arcturus (1 mentions) Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions) Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions) Rnase free dnase digestion, by Qiagen (1 mentions)

13 protocols using picopure kit

1

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were FACS sorted into 50–100 µl of extraction buffer (Arcturus PicoPure kit), and RNA was isolated with the PicoPure RNA isolation kit (Arcturus). RNA was reverse transcribed with the SuperScript VILO cDNA synthesis kit (Invitrogen). For qRT-PCR, the ViiA 7 Real-Time PCR system (Applied Biosystems) was used with 384-well plates. Sdha was used as the housekeeping gene for normalization. Relative gene expression was calculated by the comparative ΔΔ cycle threshold method. The primers used in the real-time PCR were: Matn4 forward, 5′-TTAGCACCATGACGCACCT-3′; reverse, 5′-GGACTCCGAAGCTCTGTCC-3′; CXCR4 forward, 5′-GACTGGCATAGTCGGCAATG-3′; reverse, 5′-AGAAGGGGAGTGTGATGACAAA-3′; SDHA forward, 5′-AAGTTGAGATTTGCCGATGG-3′; and reverse, 5′-TGGTTCTGCATCGACTTCTG-3′.
Uckelmann H., Blaszkiewicz S., Nicolae C., Haas S., Schnell A., Wurzer S., Wagener R., Aszodi A, & Essers M.A. (2016). Extracellular matrix protein Matrilin-4 regulates stress-induced HSC proliferation via CXCR4. The Journal of Experimental Medicine, 213(10), 1961-1971.
+ Open protocol
+ Expand
2

Mouse Genome-wide Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated with the PicoPure kit (Arcturus, Applied Biosystems) according to the manufacturer’s protocol including a DNase I treatment (Qiagen, Venlo, The Netherlands) to remove genomic DNA contamination. RNA quality was assessed on the bioanalyzer (Agilent Technologies, Amstelveen, The Netherlands) and samples with a RIN>8 were accepted. The RNA was reverse transcribed, amplified, biotinylated and fragmented with the Ovation Pico WTA v2 and Encore Biotin Module (NuGEN Technologies, Leek, The Netherlands) and subsequently hybridized on Mouse Genome 430 2.0 Arrays (Affymetrix, High Wycombe, UK) according to the manufacturers protocols. The raw data containing.CEL files, including metadata and matrix with normalized gene expression were uploaded to GEO and will be accessible from publication date under accession number: GSE45028 at http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE45028.
Beumer W., Welzen-Coppens J.M., van Helden-Meeuwsen C.G., Gibney S.M., Drexhage H.A, & Versnel M.A. (2014). The Gene Expression Profile of CD11c+CD8α− Dendritic Cells in the Pre-Diabetic Pancreas of the NOD Mouse. PLoS ONE, 9(8), e103404.
+ Open protocol
+ Expand
3

Identifying kdr Mutations in Aedes Mosquitoes

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
To identify potential kdr mutations, a fragment of the coding region of the VGSC gene spanning exon 19 to exon 31 (covering the 989, 1011, 1016 and 1534 coding positions) was amplified from cDNA samples and directly sequenced. RNA was extracted from pools of three batches of 10 mosquitoes (not exposed to any insecticide for Ae. aegypti or from DDT resistant for Ae. albopictus) from all the four locations using Picopure kit (Arcturus). cDNA were synthesised using the Superscript III kit (Invitrogen) with oligo-dT20 and RNase H as previously described [21 (link),22 (link)]. The PCR was carried out using 10 pmol of each primers (Additional file 1: Table S1) and 20 ng of cDNA as template in 15 μl reactions containing 1X HF buffer A, 0.2 mM dNTPs, 1.5 mM MgCl2, 1U Phusion Taq. The cycle conditions were 98°C for 1 min and 35 cycles of 98°C for 10 s, 63°C (60 for Ae. albopictus) for 30 s and 72°C for 1 min and 30 s, followed by a final extension step of 72°C for 10 min. The samples were purified using the Qiaquick PCR purification kit (Qiagen) and sequenced directly. The sequences were aligned and analysed as indicated above.
Ishak I.H., Jaal Z., Ranson H, & Wondji C.S. (2015). Contrasting patterns of insecticide resistance and knockdown resistance (kdr) in the dengue vectors Aedes aegypti and Aedes albopictus from Malaysia. Parasites & Vectors, 8, 181.
+ Open protocol
+ Expand
4

Gene Expression Analysis of Immune Cell Interactions

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
After 3 days of co-culture with 2.5x103 (NanoString) or 2x104 (RNA-Seq) HSPCs or 2x104 DCs, CD4+ T cells were FACS-sorted and lysed in RLT Buffer (Qiagen) with 1% β-mercaptoethanol (Sigma). For NanoString, RNA was hybridized with the PanCancer Mouse Immune Profiling CodeSet provided by NanoString Technologies. The barcodes were counted on an nCounter Digital Analyzer. The obtained raw data was analyzed using the nSolver Analysis Software. For RNA-Seq, 5x103 THSC or TDC were sorted and RNA was extracted using Arcturus PicoPure Kit, and reverse transcribed, amplified and tagmented using the SmartSeq2 protocol (Picelli et al., 2013 (link), 2014 (link)) and using a homemade Tn5 enzyme and sequenced on an Illumina NextSeq 550 (75bp high-output). Reads were aligned to the murine reference genome (Ensembl GRCm38) using STAR v2.5.2b. Gene count tables were generated using Gencode M12 annotations. Differential expression between samples was tested using the R/Bioconductor package DESeq2 (Love, Huber and Anders, 2014 (link)). GSEA was run with the R/Bioconductor package clusterProfiler (Yu et al., 2012 (link)) and PCA was performed with FactoMineR (LÊ et al., 2008 ).
Hernández-Malmierca P., Vonficht D., Schnell A., Uckelmann H.J., Bollhagen A., Mahmoud M.A., Landua S.L., van der Salm E., Trautmann C.L., Raffel S., Grünschläger F., Lutz R., Ghosh M., Renders S., Correia N., Donato E., Dixon K.O., Hirche C., Andresen C., Robens C., Werner P.S., Boch T., Eisel D., Osen W., Pilz F., Przybylla A., Klein C., Buchholz F., Milsom M.D., Essers M.A., Eichmüller S.B., Hofmann W.K., Nowak D., Hübschmann D., Hundemer M., Thiede C., Bullinger L., Müller-Tidow C., Armstrong S.A., Trumpp A., Kuchroo V.K, & Haas S. (2022). Antigen presentation safeguards the integrity of the hematopoietic stem cell pool. Cell stem cell, 29(5), 760-775.e10.
+ Open protocol
+ Expand
5

Isolation and RNA-seq of Undifferentiated Spermatogonial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
WT and FR mice (n = 3/ group) were treated with tamoxifen for four days for twice over two weeks. The testes were dissociated (see Fig 1A) and RNA from tdTomato+ MCAM-bright Aundiff was isolated via Arcturus PicoPure kit with DNase I treatment. Mean RNA Integrity Number (RIN) was 9.47 (SD 0.31). Libraries were constructed using TruSeq Stranded mRNA. Sequencing was performed on an Illumina HiSeq 2500 (v4 chemistry) with a 50 bp paired-end protocol. Variant calling and filtering were carried out using Bam-Readcount and SAMtools mpileup at chr7:141192906, where samples with heterozygous HrasG12V (c.35G>T) mutation should have evidence of a C/A genotype while wild-type samples have only a C genotype. Differential expression was assessed using DESeq2 with a false discovery rate (FDR) of 0.1.
Yamada M., Cai W., Martin L.A., N’Tumba-Byn T, & Seandel M. (2019). Functional robustness of adult spermatogonial stem cells after induction of hyperactive Hras. PLoS Genetics, 15(5), e1008139.
+ Open protocol
+ Expand
6

Fetal Adrenal Neuroblast Transcriptome

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ethical approval was obtained for the collection of fetal adrenal glands from fetuses aborted for clinical reasons and informed consent was obtained for the use of all samples (Ethics committee Erasme Hospital, Brussels, Belgium; approval no.: OM021). All methods were carried out in accordance with relevant guidelines and regulations. Neuroblasts were isolated from 3 fetal adrenal glands from 13–16 week gestation embryos using laser capture microdissection. We extracted RNA from 6 neuroblast clusters and 3 areas of adjacent normal adrenal cortex as controls using the PicoPure kit (ARCTURUS). Samples were PCR amplified (SMART-Seq v4 ultra low input RNA kit, Takara Bio) and sequenced on the Illumina Hiseq 4000 platform to create a unique resource of neuroblast mRNA and lincRNA expression data.
Rombaut D., Chiu H.S., Decaesteker B., Everaert C., Yigit N., Peltier A., Janoueix-Lerosey I., Bartenhagen C., Fischer M., Roberts S., D’Haene N., De Preter K., Speleman F., Denecker G., Sumazin P., Vandesompele J., Lefever S, & Mestdagh P. (2019). Integrative analysis identifies lincRNAs up- and downstream of neuroblastoma driver genes. Scientific Reports, 9, 5685.
+ Open protocol
+ Expand
7

Microdissection and RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Leaf tissues from Col-0 and atmyb60-1 plants were prepared according to Kerk et al.47 (link) and microdissected using the Pix‐Cell II LCM system (Arcturus Engineering). RNA from LCM‐harvested cells was prepared using the PicoPure kit (Arcturus Engineering), and reverse‐transcribed using the Superscript™ II reverse transcriptase (Invitrogen).
Simeoni F., Skirycz A., Simoni L., Castorina G., de Souza L.P., Fernie A.R., Alseekh S., Giavalisco P., Conti L., Tonelli C, & Galbiati M. (2022). The AtMYB60 transcription factor regulates stomatal opening by modulating oxylipin synthesis in guard cells. Scientific Reports, 12, 533.
+ Open protocol
+ Expand
8

RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from FACS-purified BM populations using the PicoPure Kit (Arcturus Bioscience), and subjected to reverse transcription with SuperScript III First-Strand Synthesis System (Invitrogen). qPCR assays were performed on an ABI 7500 Fast Real-Time PCR System, using the TaqMan Universal PCR master mixture (Applied Biosystem, Foster City, CA).
Usenko T., Chan G., Torlakovic E., Klingmüller U, & Neel B.G. (2014). Leukemogenic Ptpn11 Allele Causes Defective Erythropoiesis in Mice. PLoS ONE, 9(10), e109682.
+ Open protocol
+ Expand
9

RNA Extraction and Sequencing Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells from five biological replicates per condition (DsRed+OHT, Ascl1ERT2+OHT, NeurogERT2+OHT) and 2 replicates for DsRed-OHT-untreated condition were sorted and their RNA extracted with PicoPure Kit (Arcturus, Kit0204). One entire biological replicate (DsRed+OHT, Ascl1ERT2+OHT, NeurogERT2+OHT) was removed from the analysis because of the low reads in one of the samples (DsRed+OHT). GEO number GSE174238.
Kempf J., Knelles K., Hersbach B.A., Petrik D., Riedemann T., Bednarova V., Janjic A., Simon-Ebert T., Enard W., Smialowski P., Götz M, & Masserdotti G. (2021). Heterogeneity of neurons reprogrammed from spinal cord astrocytes by the proneural factors Ascl1 and Neurogenin2. Cell Reports, 36(3), 109409.
+ Open protocol
+ Expand
10

Olfactory Receptor Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The entire olfactory epithelium from either wild type or Shh(ala/ala) mice was dissected and homogenized in 1 ml Trizol (Invitrogen). RNA was isolated following the manufacturer's instructions, and the purified nucleic acid was resuspended in 200 μL XB buffer (picopure kit, Arcturus). Contaminating genomic DNA was removed by RNAse-free DNAse digestion (Qiagen) and column purified using the picopure kit according to the manufacturer's instructions. The purified RNA was quantified by nanodrop, and 1 mg of total RNA per mouse was converted to cDNA by reverse transcription with SuperscriptIII (Invitrogen) per manufacturer's instructions. qRT-PCR was performed using Power SYBR green master mix, and all reactions were performed in triplicate. The expression of olfactory receptors was normalized to the expression of gapdh. Probes used were: Shh (Mm00436527_m1), Ptch1 (Mm00436026_m1), Glypican 5 (Mm00615599_m1), Gli1 (Mm00494645_m1), MOR23 (F: TGCTCACAGCAATGGGTTATGATCGTT, R: TGGC TGGCACATGAAGAACTGCC), MOR28 (F: TCGCTATG TGGCCATTTGTAAACCTT, R: AGATATGGAGTGTATG GTCCCTGCTG), M72 (F: TGCCATGGGACTCATAGGC TCAA, R: AGCAAGAGAGCTTCATGAGGGGG), 174-9 (F: AGTCAGCAAGTGGACGCCGC, R: ACACAGAGGCC ACTTTTACGGTATGC), P2 (F: ACCATTCCTTCCTTGG CTGTGC, R: TGCAAGGGATCACAGATCGCCA).
Persson L., Witt R.M., Galligan M., Greer P.L., Eisner A., Pazyra-Murphy M.F., Datta S.R, & Segal R.A. (2014). Shh-Proteoglycan Interactions Regulate Maturation of Olfactory Glomerular Circuitry. Developmental neurobiology, 74(12), 1255-1267.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!